C-reactive protein (CRP) is an acute-phase protein that includes a homopentameric construction and Ca-binding specificity for phosphocholine (PCh). Expression of CRP is regulated primarily on the transcriptional degree with interleukin-6 being the principal inducer of the gene in the course of the acute section. The crystal construction of CRP has been decided and the topology and chemical composition of its ligand-binding web site decided. The huge distribution of PCh in polysaccharides of pathogens and in mobile membranes permits CRP to acknowledge a variety of pathogenic targets in addition to membranes of broken and necrotic host cells. CRP sure to a multivalent ligand can effectively provoke the meeting of a C3 convertase by the classical pathway and thus beautify the floor of the ligand with opsonic complement fragments.
However, the protein doesn’t favor the formation of a C5 convertase and subsequently, CRP-initiated complement activation doesn’t mediate acute inflammatory reactions and membrane injury. CRP additionally interacts with Fc receptors on phagocytic cells and acts as an opsonin. Other CRP-initiated alerts by interactions with neutrophil Fc receptors have an total anti-inflammatory impact. Thus, the principle organic operate of CRP seems to be host protection towards bacterial pathogens and clearance of apoptotic and necrotic cells. Protection from deadly bacterial an infection, from complement-induced alveolitis, and from endotoxemia has been confirmed in vivo utilizing transgenic mice.
Additional capabilities, together with participation in atherogenesis and pathogenesis of myocardial damage after myocardial infarction have been reported. However, the burden of the proof is that CRP like different acute-phase proteins is a part first line of innate host protection. Calcium oxalate (CaOx) crystals are distributed amongst all taxonomic ranges of photosynthetic organisms from small algae to angiosperms and big gymnosperms. Accumulation of crystals by these organisms will be substantial. Major capabilities of CaOx crystal formation in crops embrace high-capacity calcium (Ca) regulation and safety towards herbivory.
Ultrastructural and developmental analyses have demonstrated that this biomineralization course of will not be a easy random physical-chemical precipitation of endogenously synthesized oxalic acid and environmentally derived Ca. Instead, crystals are shaped in particular shapes and sizes. Genetic regulation of CaOx formation is indicated by fidelity of crystal morphology inside species, cell specialization, and the outstanding coordination of crystal development and cell growth. Using a wide range of approaches, researchers have begun to unravel the beautiful management mechanisms exerted by cells specialised for CaOx formation that embrace the equipment for uptake and accumulation of Ca, oxalic acid biosynthetic pathways, and regulation of crystal development.
Expression of bitter style receptors of the T2R household within the gastrointestinal tract and enteroendocrine STC-1 cells.
Although a job for the gastric and intestinal mucosa in molecular sensing has been identified for many years, the preliminary molecular recognition occasions that sense the chemical composition of the luminal contents has remained elusive. Here we recognized putative style receptor gene transcripts within the gastrointestinal tract. Our outcomes, utilizing reverse transcriptase-PCR, exhibit the presence of transcripts akin to a number of members of the T2R household of bitter style receptors within the antral and fundic gastric mucosa in addition to within the lining of the duodenum.
In addition, cDNA clones of T2R receptors have been detected in a rat gastric endocrine cell cDNA library, suggesting that these receptors are expressed, no less than partly, in enteroendocrine cells. Accordingly, expression of a number of T2R receptors additionally was present in STC-1 cells, an enteroendocrine cell line. The expression of alpha subunits of G proteins implicated in intracellular style sign transduction, particularly Galpha(gust), and Galpha(t)-(2), additionally was demonstrated within the gastrointestinal mucosa in addition to in STC-1 cells, as revealed by reverse transcriptase-PCR and DNA sequencing, immunohistochemistry, and Western blotting.
Furthermore, addition of compounds extensively utilized in bitter style signaling (e.g., denatonium, phenylthiocarbamide, 6-n-propil-2-thiouracil, and cycloheximide) to STC-1 cells promoted a speedy enhance in intracellular Ca(2+) focus. These outcomes exhibit the expression of bitter style receptors of the T2R household within the mouse and rat gastrointestinal tract. Many excessive threshold, voltage-gated CaCaCa(2+)-sensitive inactivation, its molecular mechanism is known solely in broad define. We now exhibit that Ca(2+)-dependent inactivation transpires by a Ca(2+)-induced shift of channel gating to a low open chance mode, distinguished by a greater than 100-fold discount of entry fee to the open state.
A gating mechanism that explains this shift quantitatively and allows profitable separation of Ca(2+)- and voltage-sensitive types of inactivation is deduced and examined. Finally, each calmodulin activation and channel (de)phosphorylation are excluded as vital signaling occasions underlying Ca(2+)-induced mode shifts, leaving direct binding of Cachemical initiation occasion for inactivation. The program features a neural community educated to establish secondary construction from residue sequence and chemical shifts.
In vivo imaging of C. elegans ASH neurons: mobile response and adaptation to chemical repellents.
ASH sensory neurons are required in Caenorhabditis elegans for a variety of avoidance behaviors in response to chemical repellents, excessive osmotic options and nostril contact. The ASH neurons are subsequently hypothesized to be polymodal nociceptive neurons. To perceive the character of polymodal sensory response and adaptation on the mobile degree, we expressed the calcium indicator protein cameleon in ASH and analyzed intracellular Ca(2+) responses following stimulation with chemical repellents, osmotic shock and nostril contact.
 Anti-CASP2 antibody |
|
STJ111030 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Caspases mediate cellular apoptosis through the proteolytic cleavage of specific protein substrates. The encoded protein may function in stress-induced cell death pathways, cell cycle maintenance, and the suppression of tumorigenesis. Increased expression of this gene may play a role in neurodegenerative disorders including Alzheimer's disease, Huntington's disease and temporal lobe epilepsy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. |
 Rabbit Polyclonal antibody Anti-CRBN |
|
Anti-CRBN |
ImmunoStep |
50 µg |
EUR 349 |
 Anti-Caspase-2/CASP2 Antibody |
|
A02384-1 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-Caspase-2/CASP2 Antibody |
|
PB9368 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-Caspase-2/CASP2 Antibody |
|
PA1113 |
BosterBio |
100ug/vial |
EUR 294 |
 CASP2 Antibody |
|
AF7578 |
Affbiotech |
200ul |
EUR 376 |
|
Description: CASP2 Antibody detects endogenous levels of CASP2. |
 CASP2 antibody |
|
70R-31129 |
Fitzgerald |
100 ug |
EUR 327 |
|
Description: Rabbit polyclonal CASP2 antibody |
CASP2 Antibody |
|
31011-100ul |
SAB |
100ul |
EUR 252 |
CASP2 Antibody |
|
31011-50ul |
SAB |
50ul |
EUR 187 |
CASP2 Antibody |
|
32995-100ul |
SAB |
100ul |
EUR 252 |
CASP2 antibody |
|
70R-16178 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal CASP2 antibody |
CASP2 Antibody |
|
DF7642 |
Affbiotech |
200ul |
EUR 304 |
|
Description: CASP2 Antibody detects endogenous levels of total CASP2. |
CASP2 Antibody |
|
1-CSB-PA001230 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against CASP2. Recognizes CASP2 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000 |
CASP2 Antibody |
|
1-CSB-PA004547GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against CASP2. Recognizes CASP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
CASP2 Antibody |
|
1-CSB-PA004547LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against CASP2. Recognizes CASP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:1000-1:2000, IF:1:200-1:500 |
CASP2 Antibody |
|
1-CSB-PA198247 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against CASP2. Recognizes CASP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:10000, WB:1:1000-1:5000 |
CASP2 Antibody |
|
1-CSB-PA076198 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against CASP2. Recognizes CASP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:10000, WB:1:1000-1:2000, IHC:1:100-1:300 |
 CASP2 Conjugated Antibody |
|
C32995 |
SAB |
100ul |
EUR 397 |
CASP2 Conjugated Antibody |
|
C31011 |
SAB |
100ul |
EUR 397 |
 CASP2 Polyclonal Antibody |
|
A57285 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: Ask the seller for details |
) CASP2 antibody (Thr325) |
|
70R-31131 |
Fitzgerald |
100 ug |
EUR 327 |
|
Description: Rabbit polyclonal CASP2 antibody (Thr325) |
 CASP2 siRNA |
|
20-abx900801 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CASP2 siRNA |
|
20-abx910335 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CASP2 siRNA |
|
20-abx910336 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Antibody) Phospho-CASP2(Ser340) Antibody |
|
AF7078 |
Affbiotech |
200ul |
EUR 376 |
|
Description: Phospho-CASP2(Ser340) Antibody detects endogenous levels of CASP2 only when phosphorylated at Ser340. |
 Antibody) Caspase 2 (CASP2) Antibody |
|
20-abx125303 |
Abbexa |
-
EUR 495.00
-
EUR 704.00
-
EUR 356.00
|
|
- Shipped within 5-10 working days.
|
Caspase 2 (CASP2) Antibody |
|
20-abx126850 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Caspase 2 (CASP2) Antibody |
|
20-abx111422 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Caspase 2 (CASP2) Antibody |
|
20-abx129512 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1135.00
-
EUR 551.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Caspase 2 (CASP2) Antibody |
|
20-abx121314 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Caspase 2 (CASP2) Antibody |
|
abx148935-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Caspase 2 (CASP2) Antibody |
|
abx038262-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Caspase 2 (CASP2) Antibody |
|
20-abx100447 |
Abbexa |
-
EUR 398.00
-
EUR 133.00
-
EUR 1094.00
-
EUR 537.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Caspase 2 (CASP2) Antibody |
|
20-abx100448 |
Abbexa |
-
EUR 398.00
-
EUR 133.00
-
EUR 1107.00
-
EUR 537.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Caspase 2 (CASP2) Antibody |
|
abx025485-100ul |
Abbexa |
100 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Caspase 2 (CASP2) Antibody |
|
20-abx004377 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Caspase 2 (CASP2) Antibody |
|
abx027316-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Caspase 2 (CASP2) Antibody |
|
abx027316-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Caspase 2 (CASP2) Antibody |
|
20-abx323897 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Caspase 2 (CASP2) Antibody |
|
20-abx324380 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Caspase 2 (CASP2) Antibody |
|
20-abx327196 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Caspase 2 (CASP2) Antibody |
|
abx340018-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Caspase 2 (CASP2) Antibody |
|
20-abx303307 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Caspase 2 (CASP2) Antibody |
|
20-abx213633 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Caspase 2 (CASP2) Antibody |
|
20-abx213638 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Caspase 2 (CASP2) Antibody |
|
abx231287-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Caspase 2 (CASP2) Antibody |
|
abx231288-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
 Antibody) CASP2 (Phospho-Ser340) Antibody |
|
12943-100ul |
SAB |
100ul |
EUR 252 |
CASP2 (Phospho-Ser340) Antibody |
|
12943-50ul |
SAB |
50ul |
EUR 187 |
 Antibody) Cleaved-CASP2 (G170) Antibody |
|
1-CSB-PA000019 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against Cleaved-CASP2 (G170). Recognizes Cleaved-CASP2 (G170) from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000 |
 CASP2 Antibody, HRP conjugated |
|
1-CSB-PA004547LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against CASP2. Recognizes CASP2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 CASP2 Antibody, FITC conjugated |
|
1-CSB-PA004547LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against CASP2. Recognizes CASP2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 CASP2 Antibody, Biotin conjugated |
|
1-CSB-PA004547LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against CASP2. Recognizes CASP2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 Antibody) Cleaved-CASP2 (T325) Antibody |
|
1-CSB-PA060254 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against Cleaved-CASP2 (T325). Recognizes Cleaved-CASP2 (T325) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000 |
 Antibody) Phospho-CASP2 (S157) Antibody |
|
1-CSB-PA060255 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against Phospho-CASP2 (S157). Recognizes Phospho-CASP2 (S157) from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000 |
 Polyclonal Goat anti-GST α-form |
|
GST-ANTI-1 |
Detroit R&D |
50 uL |
EUR 280 |
 Polyclonal Goat anti-GST μ-form |
|
GST-ANTI-2 |
Detroit R&D |
50 uL |
EUR 280 |
 Polyclonal Goat anti-GST p-form |
|
GST-ANTI-3 |
Detroit R&D |
50 uL |
EUR 280 |
 CASP2 Blocking Peptide |
|
AF7578-BP |
Affbiotech |
1mg |
EUR 195 |
 CASP2 cloning plasmid |
|
CSB-CL004547HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1359
- Sequence: atggcggcgccgagcgcggggtcttggtccaccttccagcacaaggagctgatggccgctgacaggggacgcaggatattgggagtgtgtggcatgcatcctcatcatcaggaaactctaaaaaagaaccgagtggtgctagccaaacagctgttgttgagcgaattattagaac
- Show more
|
|
Description: A cloning plasmid for the CASP2 gene. |
CASP2 Blocking Peptide |
|
DF7642-BP |
Affbiotech |
1mg |
EUR 195 |
 Polyclonal CASP2 / Caspase 2 Antibody |
|
APG02378G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CASP2 / Caspase 2 . This antibody is tested and proven to work in the following applications: |
Polyclonal CASP2 / Caspase 2 Antibody |
|
APG02379G |
Leading Biology |
0.05ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CASP2 / Caspase 2 . This antibody is tested and proven to work in the following applications: |
 Antibody (FITC)) Caspase 2 (CASP2) Antibody (FITC) |
|
20-abx273822 |
Abbexa |
-
EUR 481.00
-
EUR 244.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
 Antibody (Biotin)) Caspase 2 (CASP2) Antibody (Biotin) |
|
20-abx271958 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
 Antibody (HRP)) Caspase 2 (CASP2) Antibody (HRP) |
|
20-abx303308 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Caspase 2 (CASP2) Antibody (FITC) |
|
20-abx303309 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Caspase 2 (CASP2) Antibody (Biotin) |
|
20-abx303310 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 CASP2 Polyclonal Antibody, HRP Conjugated |
|
A57286 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 CASP2 Polyclonal Antibody, FITC Conjugated |
|
A57287 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: kits suitable for this type of research |
 CASP2 Polyclonal Antibody, Biotin Conjugated |
|
A57288 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: fast delivery possible |
 Polyclonal Conjugated Antibody) CASP2 (Phospho-Ser340) Polyclonal Conjugated Antibody |
|
C12943 |
SAB |
100ul |
EUR 397 |
 Polyclonal Antibody (Mouse)) Caspase 2 (CASP2) Polyclonal Antibody (Mouse) |
|
4-PAA244Hu01 |
Cloud-Clone |
-
EUR 232.00
-
EUR 2285.00
-
EUR 574.00
-
EUR 289.00
-
EUR 208.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CASP2 (Gly334~Thr452)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Caspase 2 (CASP2) |
 Polyclonal Antibody (Human)) Caspase 2 (CASP2) Polyclonal Antibody (Human) |
|
4-PAA244Hu02 |
Cloud-Clone |
-
EUR 232.00
-
EUR 2272.00
-
EUR 571.00
-
EUR 288.00
-
EUR 207.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Caspase 2 (CASP2) |
Caspase 2 (CASP2) Polyclonal Antibody (Mouse) |
|
4-PAA244Mu01 |
Cloud-Clone |
-
EUR 236.00
-
EUR 2338.00
-
EUR 586.00
-
EUR 294.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CASP2 (Gly170~Asp333)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Caspase 2 (CASP2) |
 Rat CASP2 shRNA Plasmid |
|
20-abx986203 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human CASP2 shRNA Plasmid |
|
20-abx950589 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) CASP2 protein (His tag) |
|
80R-3821 |
Fitzgerald |
100 ug |
EUR 327 |
|
Description: Purified recombinant CASP2 protein (His tag) |
 Mouse CASP2 shRNA Plasmid |
|
20-abx969482 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) Human Caspase-2 (CASP2) |
|
1-CSB-EP004547HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 66.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Human Caspase-2(CASP2) expressed in E.coli |
) Recombinant Caspase 2 (CASP2) |
|
4-RPA244Hu01 |
Cloud-Clone |
-
EUR 548.00
-
EUR 250.00
-
EUR 1780.00
-
EUR 660.00
-
EUR 1220.00
-
EUR 430.00
-
EUR 4300.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P42575
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 15.5kDa
- Isoelectric Point: 8.5
|
|
Description: Recombinant Human Caspase 2 expressed in: E.coli |
Recombinant Caspase 2 (CASP2) |
|
4-RPA244Hu02 |
Cloud-Clone |
-
EUR 381.34
-
EUR 205.00
-
EUR 1155.04
-
EUR 451.68
-
EUR 803.36
-
EUR 318.00
-
EUR 2737.60
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P42575
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 47.5kDa
- Isoelectric Point: Inquire
|
|
Description: Recombinant Human Caspase 2 expressed in: E.coli |
Recombinant Caspase 2 (CASP2) |
|
4-RPA244Mu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P42575
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 19.9kDa
- Isoelectric Point: 5.9
|
|
Description: Recombinant Mouse Caspase 2 expressed in: E.coli |
) CASP2 Recombinant Protein (Human) |
|
RP005662 |
ABM |
100 ug |
Ask for price |
) CASP2 Recombinant Protein (Rat) |
|
RP193202 |
ABM |
100 ug |
Ask for price |
) CASP2 Recombinant Protein (Mouse) |
|
RP121262 |
ABM |
100 ug |
Ask for price |
) Polyclonal CASP2 / Caspase 2 Antibody (aa123-172) |
|
APG02380G |
Leading Biology |
0.05ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CASP2 / Caspase 2 (aa123-172). This antibody is tested and proven to work in the following applications: |
 Antibody) Caspase 2 Phospho-Ser157 (CASP2 pS157) Antibody |
|
20-abx322872 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Polyclonal Antibody (Mouse), APC) Caspase 2 (CASP2) Polyclonal Antibody (Mouse), APC |
|
4-PAA244Hu01-APC |
Cloud-Clone |
-
EUR 323.00
-
EUR 2969.00
-
EUR 836.00
-
EUR 409.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CASP2 (Gly334~Thr452)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Caspase 2 (CASP2). This antibody is labeled with APC. |
 Polyclonal Antibody (Mouse), Biotinylated) Caspase 2 (CASP2) Polyclonal Antibody (Mouse), Biotinylated |
|
4-PAA244Hu01-Biotin |
Cloud-Clone |
-
EUR 295.00
-
EUR 2235.00
-
EUR 671.00
-
EUR 358.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CASP2 (Gly334~Thr452)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Caspase 2 (CASP2). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Mouse), Cy3) Caspase 2 (CASP2) Polyclonal Antibody (Mouse), Cy3 |
|
4-PAA244Hu01-Cy3 |
Cloud-Clone |
-
EUR 390.00
-
EUR 3917.00
-
EUR 1073.00
-
EUR 504.00
-
EUR 239.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CASP2 (Gly334~Thr452)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Caspase 2 (CASP2). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Mouse), FITC) Caspase 2 (CASP2) Polyclonal Antibody (Mouse), FITC |
|
4-PAA244Hu01-FITC |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CASP2 (Gly334~Thr452)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Caspase 2 (CASP2). This antibody is labeled with FITC. |
 Polyclonal Antibody (Mouse), HRP) Caspase 2 (CASP2) Polyclonal Antibody (Mouse), HRP |
|
4-PAA244Hu01-HRP |
Cloud-Clone |
-
EUR 297.00
-
EUR 2589.00
-
EUR 741.00
-
EUR 371.00
-
EUR 199.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CASP2 (Gly334~Thr452)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Caspase 2 (CASP2). This antibody is labeled with HRP. |
 Polyclonal Antibody (Mouse), PE) Caspase 2 (CASP2) Polyclonal Antibody (Mouse), PE |
|
4-PAA244Hu01-PE |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CASP2 (Gly334~Thr452)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Caspase 2 (CASP2). This antibody is labeled with PE. |
 Polyclonal Antibody (Human), APC) Caspase 2 (CASP2) Polyclonal Antibody (Human), APC |
|
4-PAA244Hu02-APC |
Cloud-Clone |
-
EUR 323.00
-
EUR 2951.00
-
EUR 831.00
-
EUR 407.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Caspase 2 (CASP2). This antibody is labeled with APC. |
 Polyclonal Antibody (Human), Biotinylated) Caspase 2 (CASP2) Polyclonal Antibody (Human), Biotinylated |
|
4-PAA244Hu02-Biotin |
Cloud-Clone |
-
EUR 295.00
-
EUR 2222.00
-
EUR 668.00
-
EUR 357.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Caspase 2 (CASP2). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human), Cy3) Caspase 2 (CASP2) Polyclonal Antibody (Human), Cy3 |
|
4-PAA244Hu02-Cy3 |
Cloud-Clone |
-
EUR 389.00
-
EUR 3893.00
-
EUR 1067.00
-
EUR 501.00
-
EUR 237.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Caspase 2 (CASP2). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human), FITC) Caspase 2 (CASP2) Polyclonal Antibody (Human), FITC |
|
4-PAA244Hu02-FITC |
Cloud-Clone |
-
EUR 278.00
-
EUR 2380.00
-
EUR 685.00
-
EUR 346.00
-
EUR 187.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Caspase 2 (CASP2). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human), HRP) Caspase 2 (CASP2) Polyclonal Antibody (Human), HRP |
|
4-PAA244Hu02-HRP |
Cloud-Clone |
-
EUR 296.00
-
EUR 2574.00
-
EUR 737.00
-
EUR 369.00
-
EUR 198.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Caspase 2 (CASP2). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human), PE) Caspase 2 (CASP2) Polyclonal Antibody (Human), PE |
|
4-PAA244Hu02-PE |
Cloud-Clone |
-
EUR 278.00
-
EUR 2380.00
-
EUR 685.00
-
EUR 346.00
-
EUR 187.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Caspase 2 (CASP2). This antibody is labeled with PE. |
Caspase 2 (CASP2) Polyclonal Antibody (Mouse), APC |
|
4-PAA244Mu01-APC |
Cloud-Clone |
-
EUR 329.00
-
EUR 3041.00
-
EUR 854.00
-
EUR 416.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CASP2 (Gly170~Asp333)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Caspase 2 (CASP2). This antibody is labeled with APC. |
Caspase 2 (CASP2) Polyclonal Antibody (Mouse), Biotinylated |
|
4-PAA244Mu01-Biotin |
Cloud-Clone |
-
EUR 299.00
-
EUR 2288.00
-
EUR 684.00
-
EUR 363.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CASP2 (Gly170~Asp333)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Caspase 2 (CASP2). This antibody is labeled with Biotin. |
Caspase 2 (CASP2) Polyclonal Antibody (Mouse), Cy3 |
|
4-PAA244Mu01-Cy3 |
Cloud-Clone |
-
EUR 397.00
-
EUR 4013.00
-
EUR 1097.00
-
EUR 513.00
-
EUR 241.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CASP2 (Gly170~Asp333)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Caspase 2 (CASP2). This antibody is labeled with Cy3. |
Caspase 2 (CASP2) Polyclonal Antibody (Mouse), FITC |
|
4-PAA244Mu01-FITC |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CASP2 (Gly170~Asp333)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Caspase 2 (CASP2). This antibody is labeled with FITC. |
Caspase 2 (CASP2) Polyclonal Antibody (Mouse), HRP |
|
4-PAA244Mu01-HRP |
Cloud-Clone |
-
EUR 302.00
-
EUR 2652.00
-
EUR 756.00
-
EUR 377.00
-
EUR 200.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CASP2 (Gly170~Asp333)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Caspase 2 (CASP2). This antibody is labeled with HRP. |
Caspase 2 (CASP2) Polyclonal Antibody (Mouse), PE |
|
4-PAA244Mu01-PE |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CASP2 (Gly170~Asp333)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Caspase 2 (CASP2). This antibody is labeled with PE. |
 Blocking Peptide) Phospho-CASP2(Ser340) Blocking Peptide |
|
AF7078-BP |
Affbiotech |
1mg |
EUR 195 |
 Protein) Human Caspase 2 (CASP2) Protein |
|
20-abx065756 |
Abbexa |
-
EUR 759.00
-
EUR 300.00
-
EUR 2388.00
-
EUR 913.00
-
EUR 537.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Human Caspase 2 (CASP2) Protein |
|
20-abx065757 |
Abbexa |
-
EUR 537.00
-
EUR 244.00
-
EUR 1567.00
-
EUR 634.00
-
EUR 398.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 Protein) Mouse Caspase 2 (CASP2) Protein |
|
20-abx167238 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 (pORF)) CASP2 ORF Vector (Human) (pORF) |
|
ORF001888 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Casp2 ORF Vector (Mouse) (pORF) |
|
ORF040422 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Casp2 ORF Vector (Rat) (pORF) |
|
ORF064402 |
ABM |
1.0 ug DNA |
EUR 506 |
 (OKEH06482)) CASP2 ELISA Kit (Rat) (OKEH06482) |
|
OKEH06482 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
|
Description: Description of target: Involved in the activation cascade of caspases responsible for apoptosis execution. Might function by either activating some proteins required for cell death or inactivating proteins necessary for cell survival.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.19 ng/mL |
 (OKEH06548)) CASP2 ELISA Kit (Human) (OKEH06548) |
|
OKEH06548 |
Aviva Systems Biology |
96 Wells |
EUR 740 |
|
Description: Description of target: Involved in the activation cascade of caspases responsible for apoptosis execution. Might function by either activating some proteins required for cell death or inactivating proteins necessary for cell survival. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.1 pg/mL |
 (OKWB00378)) CASP2 ELISA Kit (Rat) (OKWB00378) |
|
OKWB00378 |
Aviva Systems Biology |
96 Wells |
EUR 572 |
|
Description: Description of target: Involved in the activation cascade of caspases responsible for apoptosis execution. Might function by either activating some proteins required for cell death or inactivating proteins necessary for cell survival ;Species reactivity: Rat;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL |
 Polyclonal Antibody (Mouse), APC-Cy7) Caspase 2 (CASP2) Polyclonal Antibody (Mouse), APC-Cy7 |
|
4-PAA244Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 527.00
-
EUR 5818.00
-
EUR 1552.00
-
EUR 698.00
-
EUR 301.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CASP2 (Gly334~Thr452)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Caspase 2 (CASP2). This antibody is labeled with APC-Cy7. |
 Polyclonal Antibody (Human), APC-Cy7) Caspase 2 (CASP2) Polyclonal Antibody (Human), APC-Cy7 |
|
4-PAA244Hu02-APC-Cy7 |
Cloud-Clone |
-
EUR 526.00
-
EUR 5782.00
-
EUR 1543.00
-
EUR 695.00
-
EUR 299.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Caspase 2 (CASP2). This antibody is labeled with APC-Cy7. |
Caspase 2 (CASP2) Polyclonal Antibody (Mouse), APC-Cy7 |
|
4-PAA244Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 538.00
-
EUR 5962.00
-
EUR 1588.00
-
EUR 713.00
-
EUR 304.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CASP2 (Gly170~Asp333)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Caspase 2 (CASP2). This antibody is labeled with APC-Cy7. |
 ELISA Kit) Chicken Caspase 2 (CASP2) ELISA Kit |
|
abx555357-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 1-3 weeks.
|
 ELISA Kit) Mouse Caspase 2 (CASP2) ELISA Kit |
|
abx556092-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 1-3 weeks.
|
 Human CASP2/ Caspase-2 ELISA Kit |
|
E0357Hu |
Sunlong |
1 Kit |
EUR 605 |
 ELISA Kit) Human CASP2(Caspase-2 ) ELISA Kit |
|
EH4261 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 78.125-5000 pg/ml
- Uniprot ID: P42574
- Alias: ICH1, NEDD2，Neural precursor cell expressed developmentally down-regulated protein 2，NEDD-2，Protease ICH-1
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml |
 (Human) ELISA Kit) Caspase-2 (CASP2) (Human) ELISA Kit |
|
E4589-100 |
Biovision |
|
EUR 805 |
 (Rat) ELISA Kit) Caspase-2 (CASP2) (Rat) ELISA Kit |
|
E4590-100 |
Biovision |
|
EUR 805 |
) CASP2 sgRNA CRISPR Lentivector set (Human) |
|
K0365301 |
ABM |
3 x 1.0 ug |
EUR 339 |
 ELISA Kit) Human Caspase 2 (CASP2) ELISA Kit |
|
abx257306-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 1-3 weeks.
|
 ELISA Kit) Rat Caspase 2 (CASP2) ELISA Kit |
|
abx257371-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 1-3 weeks.
|
ELISA kit) Human Caspase 2 (CASP2)ELISA kit |
|
201-12-2254 |
SunredBio |
96 tests |
EUR 440 |
- This Caspase 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Rat Casp2/ Caspase-2 ELISA Kit |
|
E0157Ra |
Sunlong |
1 Kit |
EUR 646 |
) Casp2 sgRNA CRISPR Lentivector set (Mouse) |
|
K3921001 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Casp2 sgRNA CRISPR Lentivector set (Rat) |
|
K7092101 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) CASP2 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0365302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) CASP2 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0365303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) CASP2 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0365304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Casp2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3921002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Casp2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3921003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Casp2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3921004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Casp2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7092102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Casp2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7092103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Casp2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7092104 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) CASP2 Protein Vector (Human) (pPB-C-His) |
|
PV007549 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) CASP2 Protein Vector (Human) (pPB-N-His) |
|
PV007550 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) CASP2 Protein Vector (Human) (pPM-C-HA) |
|
PV007551 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) CASP2 Protein Vector (Human) (pPM-C-His) |
|
PV007552 |
ABM |
500 ng |
EUR 329 |
We discovered that a wide range of noxious stimuli evoked sturdy responses in ASH together with quinine, denatonium, detergents, heavy metals, each hyper- and hypo-osmotic shock and nostril contact. We noticed that repeated chemical stimulation led to a reversible discount within the magnitude of the sensory response, indicating that adaptation happens throughout the ASH sensory neuron. A key part of ASH adaptation is GPC-1, a G-protein gamma-subunit expressed particularly in chemosensory neurons. We hypothesize that G-protein gamma-subunit heterogeneity gives a mechanism for repellent-specific adaptation, which might facilitate discrimination of a wide range of repellents by these polymodal sensory neurons.
ELISA kit)
ELISA kit)
ELISA Kit)