Studies of DNA methylomes maintain monumental promise for biomedicine however are hampered by the technological challenges of analyzing many samples cost-effectively. Recently, a serious extension of the earlier Infinium HumanMethylation27 BeadChip® (Illumina, Inc. CA, USA), known as Infinium HumanMethylation450 (Infinium Methylation 450Ok; Illumina, Inc. CA, USA) was developed. This upgraded expertise is a hybrid of two totally different chemical assays, the Infinium I and Infinium II assays, permitting (for 12 samples in parallel) evaluation of the methylation standing of greater than 480,000 cytosines distributed over the complete genome.
We used Infinium Methylation 450Ok to profile: first, the well-characterized HCT116 wild-type and double-knockout cell traces after which, 16 breast tissue samples (together with eight regular and eight main tumor samples). Absolute methylation values (β-values) had been extracted with the GenomeStudio™ software program after which subjected to detailed evaluation. In this text, we consider Infinium Methylation 450Ok on cell traces and tissue samples, highlighting some of its benefits but in addition some of its limitations. In explicit, we examine the methylation values of the Infinium I and Infinium II assays.
While this expertise appeared extremely sturdy as beforehand proven, we seen a divergence between the β-values retrieved from the sort I and kind II Infinium assays. Specifically, the β-values obtained from Infinium II probes had been much less correct and reproducible than these obtained from Infinium I probes. This means that information from the sort I and kind II assays must be thought of individually in any downstream bioinformatic evaluation. To have the ability to cope with the Infinium I and Infinium II information collectively, we developed and examined a brand new correction method, which we known as ‘peak-based correction’. The concept was to rescale the Infinium II information on the foundation of the Infinium I information. While this system must be seen as an approximation methodology, it considerably improves the high quality of Infinium II information.
Infinium 450Ok is a strong method in phrases of reagent prices, time of labor, pattern throughput and protection. It holds nice promise for the higher understanding of the epigenetic part in well being and illness. Yet, on account of the nature of its design comprising two totally different chemical assays, evaluation of the complete set of information will not be as straightforward as initially anticipated. Correction methods, reminiscent of the peak-based method proposed right here, are a step in the direction of enough output information evaluation.
Astrocytes set up speedy cell-to-cell communication via the launch of chemical transmitters. The underlying mechanisms and purposeful significance of this launch are, nonetheless, not properly understood. Here we determine an astrocytic vesicular compartment that’s competent for glutamate exocytosis. Using postembedding immunogold labeling of the rat hippocampus, we present that vesicular glutamate transporters (VGLUT1/2) and the vesicular SNARE protein, cellubrevin, are each expressed in small vesicular organelles that resemble synaptic vesicles of glutamatergic terminals.
Physiological, morphological, and histochemical characterization of three courses of interneurons in rat neostriatum.
Interneurons in lateral half of neostriatum had been studied in remoted slices from juvenile rats (16-20 d postnatal) by whole-cell, current-clamp recording at 33-34 levels C, adopted by intracellular staining with biocytin and double immunocytochemical or histochemical staining for parvalbumin, ChAT, and NADPH diaphorase. Medium-sized spiny neurons (MS cells) had distal dendrites with many spines and had been doubtless projection cells, whereas interneurons had dendrites with fewer spines. The neostriatal interneurons might be additional divided into three courses by physiological, chemical, and morphological standards.
The top notch of interneurons (fast-spiking cells, FS cells) fired very short-duration motion potentials with short-duration afterhyperpolarizations at fixed spike frequency throughout depolarizing present pulses. FS cells had extra destructive resting potentials and decrease enter resistances than the different two courses. At depolarized potentials, FS cells fired repetitive spikes in response to synaptic excitation. FS cells had been immunoreactive for parvalbumin. As all parvalbumin-immunoreactive cells in the neostriatum had been additionally immunoreactive for GABA, FS cells had been thought of to be GABAergic.
FS cells had been additional divided into two morphological varieties: FS cells with native dendritic fields and FS cells with prolonged dendritic fields. The axons of each varieties of FS cells had their densest collateralization inside or close to their dendritic fields. The different two courses of interneuron, PLTS cells (persistent and low-threshold spike cells) and LA cells (long-lasting afterhyperpolarization cells), had been distinguished from FS cells by longer-duration motion potentials and bigger enter resistances, had much less destructive resting potentials, and had longer-lasting afterhyperpolarizations.
CASC4 siRNA |
20-abx910317 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CASC4 siRNA |
20-abx910318 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CASC4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV708321 |
ABM |
1.0 ug DNA |
EUR 316 |
CASC4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV708325 |
ABM |
1.0 ug DNA |
EUR 316 |
CASC4 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV708326 |
ABM |
1.0 ug DNA |
EUR 316 |
CASC4 ORF Vector (Human) (pORF) |
ORF001883 |
ABM |
1.0 ug DNA |
EUR 95 |
CASC4 ORF Vector (Human) (pORF) |
ORF001884 |
ABM |
1.0 ug DNA |
EUR 95 |
Casc4 ORF Vector (Mouse) (pORF) |
ORF040409 |
ABM |
1.0 ug DNA |
EUR 506 |
Casc4 ORF Vector (Mouse) (pORF) |
ORF040410 |
ABM |
1.0 ug DNA |
EUR 506 |
Casc4 ORF Vector (Mouse) (pORF) |
ORF040411 |
ABM |
1.0 ug DNA |
EUR 506 |
Casc4 ORF Vector (Mouse) (pORF) |
ORF040412 |
ABM |
1.0 ug DNA |
EUR 506 |
Casc4 ORF Vector (Mouse) (pORF) |
ORF040413 |
ABM |
1.0 ug DNA |
EUR 506 |
CASC4 cloning plasmid |
CSB-CL764724HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 534
- Sequence: atggtgggtttcggggccaaccggcgggctggccgcctgccctctctcgtgctggtggtgctgctggtggtgatcgtcgtcctcgccttcaactactggagcatctcctcccgccacgtcctgcttcaggaggaggtggccgagctgcagggccaggtccagcgcaccgaagtggc
- Show more
|
Description: A cloning plasmid for the CASC4 gene. |
CASC4 cloning plasmid |
CSB-CL764724HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1302
- Sequence: atggtgggtttcggggccaaccggcgggctggccgcctgccctctctcgtgctggtggtgctgctggtggtgatcgtcgtcctcgccttcaactactggagcatctcctcccgccacgtcctgcttcaggaggaggtggccgagctgcagggccaggtccagcgcaccgaagtgg
- Show more
|
Description: A cloning plasmid for the CASC4 gene. |
Human CASC4 shRNA Plasmid |
20-abx964315 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse CASC4 shRNA Plasmid |
20-abx983339 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CASC4 Recombinant Protein (Human) |
RP005647 |
ABM |
100 ug |
Ask for price |
CASC4 Recombinant Protein (Human) |
RP005650 |
ABM |
100 ug |
Ask for price |
CASC4 Recombinant Protein (Mouse) |
RP121223 |
ABM |
100 ug |
Ask for price |
CASC4 Recombinant Protein (Mouse) |
RP121226 |
ABM |
100 ug |
Ask for price |
CASC4 Recombinant Protein (Mouse) |
RP121229 |
ABM |
100 ug |
Ask for price |
CASC4 Recombinant Protein (Mouse) |
RP121232 |
ABM |
100 ug |
Ask for price |
CASC4 Recombinant Protein (Mouse) |
RP121235 |
ABM |
100 ug |
Ask for price |
CASC4 Protein Vector (Mouse) (pPB-C-His) |
PV161634 |
ABM |
500 ng |
EUR 603 |
CASC4 Protein Vector (Mouse) (pPB-N-His) |
PV161635 |
ABM |
500 ng |
EUR 603 |
CASC4 Protein Vector (Mouse) (pPM-C-HA) |
PV161636 |
ABM |
500 ng |
EUR 603 |
CASC4 Protein Vector (Mouse) (pPM-C-His) |
PV161637 |
ABM |
500 ng |
EUR 603 |
CASC4 Protein Vector (Mouse) (pPB-C-His) |
PV161638 |
ABM |
500 ng |
EUR 603 |
CASC4 Protein Vector (Mouse) (pPB-N-His) |
PV161639 |
ABM |
500 ng |
EUR 603 |
CASC4 Protein Vector (Mouse) (pPM-C-HA) |
PV161640 |
ABM |
500 ng |
EUR 603 |
CASC4 Protein Vector (Mouse) (pPM-C-His) |
PV161641 |
ABM |
500 ng |
EUR 603 |
CASC4 Protein Vector (Mouse) (pPB-C-His) |
PV161642 |
ABM |
500 ng |
EUR 603 |
CASC4 Protein Vector (Mouse) (pPB-N-His) |
PV161643 |
ABM |
500 ng |
EUR 603 |
CASC4 Protein Vector (Mouse) (pPM-C-HA) |
PV161644 |
ABM |
500 ng |
EUR 603 |
CASC4 Protein Vector (Mouse) (pPM-C-His) |
PV161645 |
ABM |
500 ng |
EUR 603 |
CASC4 Protein Vector (Mouse) (pPB-C-His) |
PV161646 |
ABM |
500 ng |
EUR 603 |
CASC4 Protein Vector (Mouse) (pPB-N-His) |
PV161647 |
ABM |
500 ng |
EUR 603 |
CASC4 Protein Vector (Mouse) (pPM-C-HA) |
PV161648 |
ABM |
500 ng |
EUR 603 |
CASC4 Protein Vector (Mouse) (pPM-C-His) |
PV161649 |
ABM |
500 ng |
EUR 603 |
CASC4 Protein Vector (Mouse) (pPB-C-His) |
PV161650 |
ABM |
500 ng |
EUR 603 |
CASC4 Protein Vector (Mouse) (pPB-N-His) |
PV161651 |
ABM |
500 ng |
EUR 603 |
CASC4 Protein Vector (Mouse) (pPM-C-HA) |
PV161652 |
ABM |
500 ng |
EUR 603 |
CASC4 Protein Vector (Mouse) (pPM-C-His) |
PV161653 |
ABM |
500 ng |
EUR 603 |
CASC4 Protein Vector (Human) (pPB-C-His) |
PV007529 |
ABM |
500 ng |
EUR 329 |
CASC4 Protein Vector (Human) (pPB-N-His) |
PV007530 |
ABM |
500 ng |
EUR 329 |
CASC4 Protein Vector (Human) (pPM-C-HA) |
PV007531 |
ABM |
500 ng |
EUR 329 |
CASC4 Protein Vector (Human) (pPM-C-His) |
PV007532 |
ABM |
500 ng |
EUR 329 |
CASC4 Protein Vector (Human) (pPB-C-His) |
PV007533 |
ABM |
500 ng |
EUR 329 |
CASC4 Protein Vector (Human) (pPB-N-His) |
PV007534 |
ABM |
500 ng |
EUR 329 |
CASC4 Protein Vector (Human) (pPM-C-HA) |
PV007535 |
ABM |
500 ng |
EUR 329 |
CASC4 Protein Vector (Human) (pPM-C-His) |
PV007536 |
ABM |
500 ng |
EUR 329 |
CASC4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA) |
LV708322 |
ABM |
1.0 ug DNA |
EUR 316 |
CASC4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro) |
LV708323 |
ABM |
1.0 ug DNA |
EUR 374 |
CASC4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro) |
LV708324 |
ABM |
1.0 ug DNA |
EUR 374 |
Polyclonal CASC4 Antibody (C-term) |
APR03445G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CASC4 (C-term). This antibody is tested and proven to work in the following applications: |
CASC4 sgRNA CRISPR Lentivector set (Human) |
K0364501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Casc4 sgRNA CRISPR Lentivector set (Mouse) |
K4708701 |
ABM |
3 x 1.0 ug |
EUR 339 |
CASC4 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0364502 |
ABM |
1.0 ug DNA |
EUR 154 |
CASC4 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0364503 |
ABM |
1.0 ug DNA |
EUR 154 |
CASC4 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0364504 |
ABM |
1.0 ug DNA |
EUR 154 |
Casc4 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4708702 |
ABM |
1.0 ug DNA |
EUR 154 |
Casc4 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4708703 |
ABM |
1.0 ug DNA |
EUR 154 |
Casc4 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4708704 |
ABM |
1.0 ug DNA |
EUR 154 |
Casc4 3'UTR GFP Stable Cell Line |
TU153148 |
ABM |
1.0 ml |
Ask for price |
Casc4 3'UTR Luciferase Stable Cell Line |
TU103148 |
ABM |
1.0 ml |
Ask for price |
Casc4 3'UTR Luciferase Stable Cell Line |
TU201674 |
ABM |
1.0 ml |
Ask for price |
Casc4 3'UTR GFP Stable Cell Line |
TU251674 |
ABM |
1.0 ml |
Ask for price |
CASC4 3'UTR GFP Stable Cell Line |
TU053495 |
ABM |
1.0 ml |
EUR 2333 |
CASC4 3'UTR Luciferase Stable Cell Line |
TU003495 |
ABM |
1.0 ml |
EUR 2333 |
CASC4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) |
K0364505 |
ABM |
3 x 1.0 ug |
EUR 376 |
Casc4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse) |
K4708705 |
ABM |
3 x 1.0 ug |
EUR 376 |
CASC4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1) |
K0364506 |
ABM |
1.0 ug DNA |
EUR 167 |
CASC4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2) |
K0364507 |
ABM |
1.0 ug DNA |
EUR 167 |
CASC4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3) |
K0364508 |
ABM |
1.0 ug DNA |
EUR 167 |
Casc4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1) |
K4708706 |
ABM |
1.0 ug DNA |
EUR 167 |
Casc4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2) |
K4708707 |
ABM |
1.0 ug DNA |
EUR 167 |
Casc4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3) |
K4708708 |
ABM |
1.0 ug DNA |
EUR 167 |
dCas9-KRAB Lentiviral Vector |
K203 |
ABM |
10 ug |
EUR 228 |
Cas9 Nuclease Lentiviral Vector |
K002 |
ABM |
10 ug |
EUR 154 |
Cas9 Nickase Lentiviral Vector |
K005 |
ABM |
10 ug |
EUR 154 |
pSMPUW-MNDnLacZ Lentiviral Control Vector |
LTV-402 |
Cell Biolabs |
10 µg |
EUR 618 |
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus. |
pLenti-GFP Lentiviral Control Vector |
LTV-400 |
Cell Biolabs |
100 µL |
EUR 618 |
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus. |
pSMPUW-Puro Lentiviral Expression Vector |
VPK-212 |
Cell Biolabs |
10 µg |
EUR 624 |
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer. |
pSMPUW-Neo Lentiviral Expression Vector |
VPK-213 |
Cell Biolabs |
10 µg |
EUR 624 |
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer. |
pSMPUW-Hygro Lentiviral Expression Vector |
VPK-214 |
Cell Biolabs |
10 µg |
EUR 624 |
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer. |
pLenti-RFP-Puro Lentiviral Control Vector |
LTV-403 |
Cell Biolabs |
100 µL |
EUR 618 |
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus. |
pSMPUW-GFP-LC3 Lentiviral Expression Vector |
LTV-801 |
Cell Biolabs |
10 µg |
EUR 1204 |
Description: Expression vector contains a fusion of GFP and LC3. A separate GFP control vector is also included. |
ESR1 Lentiviral Vector (Human) (pLenti-II) |
LV010008 |
ABM |
1.0 ug DNA |
EUR 316 |
pSMPUW-GFP-Puro Lentiviral Control Vector |
LTV-401 |
Cell Biolabs |
10 µg |
EUR 618 |
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus. |
pSMPUW Universal Lentiviral Expression Vector (Promoterless) |
VPK-211 |
Cell Biolabs |
10 µg |
EUR 624 |
Description: Clone your gene of interest and a gene-specific promoter into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293T or 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer. |
pSMPUW-IRES-Puro Lentiviral Expression Vector |
VPK-215 |
Cell Biolabs |
10 µg |
EUR 624 |
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer. |
pSMPUW-IRES-Neo Lentiviral Expression Vector |
VPK-216 |
Cell Biolabs |
10 µg |
EUR 624 |
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer. |
pSMPUW-IRES-Hygro Lentiviral Expression Vector |
VPK-217 |
Cell Biolabs |
10 µg |
EUR 624 |
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer. |
pSMPUW-IRES-Blasticidin Lentiviral Expression Vector |
VPK-219 |
Cell Biolabs |
10 µg |
EUR 624 |
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer. |
DPY19L1P2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV723333 |
ABM |
1.0 ug DNA |
Ask for price |
DPY19L1P2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV723334 |
ABM |
1.0 ug DNA |
Ask for price |
DRD5P1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV723353 |
ABM |
1.0 ug DNA |
Ask for price |
DRD5P1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV723357 |
ABM |
1.0 ug DNA |
Ask for price |
DRD5P1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV723358 |
ABM |
1.0 ug DNA |
Ask for price |
DRD5P2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV723359 |
ABM |
1.0 ug DNA |
Ask for price |
DRD5P2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV723363 |
ABM |
1.0 ug DNA |
Ask for price |
DRD5P2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV723364 |
ABM |
1.0 ug DNA |
Ask for price |
DSTNP1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV723383 |
ABM |
1.0 ug DNA |
Ask for price |
DSTNP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV723387 |
ABM |
1.0 ug DNA |
Ask for price |
DSTNP1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV723388 |
ABM |
1.0 ug DNA |
Ask for price |
DSTNP3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV723389 |
ABM |
1.0 ug DNA |
Ask for price |
DSTNP3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV723393 |
ABM |
1.0 ug DNA |
Ask for price |
DSTNP3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV723394 |
ABM |
1.0 ug DNA |
Ask for price |
DTX2P1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV723395 |
ABM |
1.0 ug DNA |
Ask for price |
DTX2P1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV723399 |
ABM |
1.0 ug DNA |
Ask for price |
DTX2P1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV723400 |
ABM |
1.0 ug DNA |
Ask for price |
DURS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV723401 |
ABM |
1.0 ug DNA |
Ask for price |
DURS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV723405 |
ABM |
1.0 ug DNA |
Ask for price |
DURS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV723406 |
ABM |
1.0 ug DNA |
Ask for price |
DUSPP Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV723407 |
ABM |
1.0 ug DNA |
Ask for price |
DUSPP Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV723411 |
ABM |
1.0 ug DNA |
Ask for price |
DUSPP Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV723412 |
ABM |
1.0 ug DNA |
Ask for price |
DUTP1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV723413 |
ABM |
1.0 ug DNA |
Ask for price |
DUTP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV723417 |
ABM |
1.0 ug DNA |
Ask for price |
DUTP1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV723418 |
ABM |
1.0 ug DNA |
Ask for price |
DUTP2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV723419 |
ABM |
1.0 ug DNA |
Ask for price |
DUTP2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV723423 |
ABM |
1.0 ug DNA |
Ask for price |
DUTP2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV723424 |
ABM |
1.0 ug DNA |
Ask for price |
DUTP4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV723425 |
ABM |
1.0 ug DNA |
Ask for price |
DUTP4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV723429 |
ABM |
1.0 ug DNA |
Ask for price |
DUTP4 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV723430 |
ABM |
1.0 ug DNA |
Ask for price |
DUTP5 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV723431 |
ABM |
1.0 ug DNA |
Ask for price |
DUTP5 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV723435 |
ABM |
1.0 ug DNA |
Ask for price |
DUTP5 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV723436 |
ABM |
1.0 ug DNA |
Ask for price |
DUTP6 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV723437 |
ABM |
1.0 ug DNA |
Ask for price |
DUTP6 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV723441 |
ABM |
1.0 ug DNA |
Ask for price |
DUTP6 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV723442 |
ABM |
1.0 ug DNA |
Ask for price |
DUTP7 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV723443 |
ABM |
1.0 ug DNA |
Ask for price |
DUTP7 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV723447 |
ABM |
1.0 ug DNA |
Ask for price |
DUTP7 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV723448 |
ABM |
1.0 ug DNA |
Ask for price |
DUTP8 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV723449 |
ABM |
1.0 ug DNA |
Ask for price |
DUTP8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV723453 |
ABM |
1.0 ug DNA |
Ask for price |
DUTP8 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV723454 |
ABM |
1.0 ug DNA |
Ask for price |
DUX4L8 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV723455 |
ABM |
1.0 ug DNA |
Ask for price |
DUX4L8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV723459 |
ABM |
1.0 ug DNA |
Ask for price |
Afterhyperpolarizations of PLTS cells had a shorter time to peak than these of LA cells. PLTS cells fired each Na(+)-dependent, persistent depolarization spikes and Ca(2+)-dependent, low-threshold spikes along with quick spikes. Low-threshold spikes in PLTS cells had been induced solely from hyperpolarized potentials. Both persistent depolarizations and low-threshold spikes may be evoked by synaptic activation. PLTS cells had been histochemically recognized as NADPH diaphorase-positive cells. As all NADPH diaphorase-positive cells in the identical tissue had been immunoreactive for nitric oxide (NO) synthase, PLTS cells had been thought of to launch NO. PLTS cells had the largest axonal fields.