Evaluation of the Infinium Methylation 450K technology.

Evaluation of the Infinium Methylation 450K technology.
Studies of DNA methylomes maintain monumental promise for biomedicine however are hampered by the technological challenges of analyzing many samples cost-effectively. Recently, a serious extension of the earlier Infinium HumanMethylation27 BeadChip® (Illumina, Inc. CA, USA), known as Infinium HumanMethylation450 (Infinium Methylation 450Ok; Illumina, Inc. CA, USA) was developed. This upgraded expertise is a hybrid of two totally different chemical assays, the Infinium I and Infinium II assays, permitting (for 12 samples in parallel) evaluation of the methylation standing of greater than 480,000 cytosines distributed over the complete genome.
We used Infinium Methylation 450Ok to profile: first, the well-characterized HCT116 wild-type and double-knockout cell traces after which, 16 breast tissue samples (together with eight regular and eight main tumor samples). Absolute methylation values (β-values) had been extracted with the GenomeStudio™ software program after which subjected to detailed evaluation. In this text, we consider Infinium Methylation 450Ok on cell traces and tissue samples, highlighting some of its benefits but in addition some of its limitations. In explicit, we examine the methylation values of the Infinium I and Infinium II assays.
While this expertise appeared extremely sturdy as beforehand proven, we seen a divergence between the β-values retrieved from the sort I and kind II Infinium assays. Specifically, the β-values obtained from Infinium II probes had been much less correct and reproducible than these obtained from Infinium I probes. This means that information from the sort I and kind II assays must be thought of individually in any downstream bioinformatic evaluation. To have the ability to cope with the Infinium I and Infinium II information collectively, we developed and examined a brand new correction method, which we known as ‘peak-based correction’. The concept was to rescale the Infinium II information on the foundation of the Infinium I information. While this system must be seen as an approximation methodology, it considerably improves the high quality of Infinium II information.
Infinium 450Ok is a strong method in phrases of reagent prices, time of labor, pattern throughput and protection. It holds nice promise for the higher understanding of the epigenetic part in well being and illness. Yet, on account of the nature of its design comprising two totally different chemical assays, evaluation of the complete set of information will not be as straightforward as initially anticipated. Correction methods, reminiscent of the peak-based method proposed right here, are a step in the direction of enough output information evaluation.
Astrocytes set up speedy cell-to-cell communication via the launch of chemical transmitters. The underlying mechanisms and purposeful significance of this launch are, nonetheless, not properly understood. Here we determine an astrocytic vesicular compartment that’s competent for glutamate exocytosis. Using postembedding immunogold labeling of the rat hippocampus, we present that vesicular glutamate transporters (VGLUT1/2) and the vesicular SNARE protein, cellubrevin, are each expressed in small vesicular organelles that resemble synaptic vesicles of glutamatergic terminals.
Evaluation of the Infinium Methylation 450K technology.

Physiological, morphological, and histochemical characterization of three courses of interneurons in rat neostriatum.

Interneurons in lateral half of neostriatum had been studied in remoted slices from juvenile rats (16-20 d postnatal) by whole-cell, current-clamp recording at 33-34 levels C, adopted by intracellular staining with biocytin and double immunocytochemical or histochemical staining for parvalbumin, ChAT, and NADPH diaphorase. Medium-sized spiny neurons (MS cells) had distal dendrites with many spines and had been doubtless projection cells, whereas interneurons had dendrites with fewer spines. The neostriatal interneurons might be additional divided into three courses by physiological, chemical, and morphological standards.

The top notch of interneurons (fast-spiking cells, FS cells) fired very short-duration motion potentials with short-duration afterhyperpolarizations at fixed spike frequency throughout depolarizing present pulses. FS cells had extra destructive resting potentials and decrease enter resistances than the different two courses. At depolarized potentials, FS cells fired repetitive spikes in response to synaptic excitation. FS cells had been immunoreactive for parvalbumin. As all parvalbumin-immunoreactive cells in the neostriatum had been additionally immunoreactive for GABA, FS cells had been thought of to be GABAergic.

FS cells had been additional divided into two morphological varieties: FS cells with native dendritic fields and FS cells with prolonged dendritic fields. The axons of each varieties of FS cells had their densest collateralization inside or close to their dendritic fields. The different two courses of interneuron, PLTS cells (persistent and low-threshold spike cells) and LA cells (long-lasting afterhyperpolarization cells), had been distinguished from FS cells by longer-duration motion potentials and bigger enter resistances, had much less destructive resting potentials, and had longer-lasting afterhyperpolarizations.

Mouse Protein CASC4, Casc4 ELISA KIT

ELI-33003m 96 Tests
EUR 865

Human Protein CASC4, CASC4 ELISA KIT

ELI-33933h 96 Tests
EUR 824

CASC4 siRNA

20-abx910317
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CASC4 siRNA

20-abx910318
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CASC4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV708321 1.0 ug DNA
EUR 316

CASC4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV708325 1.0 ug DNA
EUR 316

CASC4 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV708326 1.0 ug DNA
EUR 316

CASC4 ORF Vector (Human) (pORF)

ORF001883 1.0 ug DNA
EUR 95

CASC4 ORF Vector (Human) (pORF)

ORF001884 1.0 ug DNA
EUR 95

Casc4 ORF Vector (Mouse) (pORF)

ORF040409 1.0 ug DNA
EUR 506

Casc4 ORF Vector (Mouse) (pORF)

ORF040410 1.0 ug DNA
EUR 506

Casc4 ORF Vector (Mouse) (pORF)

ORF040411 1.0 ug DNA
EUR 506

Casc4 ORF Vector (Mouse) (pORF)

ORF040412 1.0 ug DNA
EUR 506

Casc4 ORF Vector (Mouse) (pORF)

ORF040413 1.0 ug DNA
EUR 506

CASC4 cloning plasmid

CSB-CL764724HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 534
  • Sequence: atggtgggtttcggggccaaccggcgggctggccgcctgccctctctcgtgctggtggtgctgctggtggtgatcgtcgtcctcgccttcaactactggagcatctcctcccgccacgtcctgcttcaggaggaggtggccgagctgcagggccaggtccagcgcaccgaagtggc
  • Show more
Description: A cloning plasmid for the CASC4 gene.

CASC4 cloning plasmid

CSB-CL764724HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1302
  • Sequence: atggtgggtttcggggccaaccggcgggctggccgcctgccctctctcgtgctggtggtgctgctggtggtgatcgtcgtcctcgccttcaactactggagcatctcctcccgccacgtcctgcttcaggaggaggtggccgagctgcagggccaggtccagcgcaccgaagtgg
  • Show more
Description: A cloning plasmid for the CASC4 gene.

Human CASC4 shRNA Plasmid

20-abx964315
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CASC4 shRNA Plasmid

20-abx983339
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CASC4 Recombinant Protein (Human)

RP005647 100 ug Ask for price

CASC4 Recombinant Protein (Human)

RP005650 100 ug Ask for price

CASC4 Recombinant Protein (Mouse)

RP121223 100 ug Ask for price

CASC4 Recombinant Protein (Mouse)

RP121226 100 ug Ask for price

CASC4 Recombinant Protein (Mouse)

RP121229 100 ug Ask for price

CASC4 Recombinant Protein (Mouse)

RP121232 100 ug Ask for price

CASC4 Recombinant Protein (Mouse)

RP121235 100 ug Ask for price

CASC4 Protein Vector (Mouse) (pPB-C-His)

PV161634 500 ng
EUR 603

CASC4 Protein Vector (Mouse) (pPB-N-His)

PV161635 500 ng
EUR 603

CASC4 Protein Vector (Mouse) (pPM-C-HA)

PV161636 500 ng
EUR 603

CASC4 Protein Vector (Mouse) (pPM-C-His)

PV161637 500 ng
EUR 603

CASC4 Protein Vector (Mouse) (pPB-C-His)

PV161638 500 ng
EUR 603

CASC4 Protein Vector (Mouse) (pPB-N-His)

PV161639 500 ng
EUR 603

CASC4 Protein Vector (Mouse) (pPM-C-HA)

PV161640 500 ng
EUR 603

CASC4 Protein Vector (Mouse) (pPM-C-His)

PV161641 500 ng
EUR 603

CASC4 Protein Vector (Mouse) (pPB-C-His)

PV161642 500 ng
EUR 603

CASC4 Protein Vector (Mouse) (pPB-N-His)

PV161643 500 ng
EUR 603

CASC4 Protein Vector (Mouse) (pPM-C-HA)

PV161644 500 ng
EUR 603

CASC4 Protein Vector (Mouse) (pPM-C-His)

PV161645 500 ng
EUR 603

CASC4 Protein Vector (Mouse) (pPB-C-His)

PV161646 500 ng
EUR 603

CASC4 Protein Vector (Mouse) (pPB-N-His)

PV161647 500 ng
EUR 603

CASC4 Protein Vector (Mouse) (pPM-C-HA)

PV161648 500 ng
EUR 603

CASC4 Protein Vector (Mouse) (pPM-C-His)

PV161649 500 ng
EUR 603

CASC4 Protein Vector (Mouse) (pPB-C-His)

PV161650 500 ng
EUR 603

CASC4 Protein Vector (Mouse) (pPB-N-His)

PV161651 500 ng
EUR 603

CASC4 Protein Vector (Mouse) (pPM-C-HA)

PV161652 500 ng
EUR 603

CASC4 Protein Vector (Mouse) (pPM-C-His)

PV161653 500 ng
EUR 603

CASC4 Protein Vector (Human) (pPB-C-His)

PV007529 500 ng
EUR 329

CASC4 Protein Vector (Human) (pPB-N-His)

PV007530 500 ng
EUR 329

CASC4 Protein Vector (Human) (pPM-C-HA)

PV007531 500 ng
EUR 329

CASC4 Protein Vector (Human) (pPM-C-His)

PV007532 500 ng
EUR 329

CASC4 Protein Vector (Human) (pPB-C-His)

PV007533 500 ng
EUR 329

CASC4 Protein Vector (Human) (pPB-N-His)

PV007534 500 ng
EUR 329

CASC4 Protein Vector (Human) (pPM-C-HA)

PV007535 500 ng
EUR 329

CASC4 Protein Vector (Human) (pPM-C-His)

PV007536 500 ng
EUR 329

CASC4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV708322 1.0 ug DNA
EUR 316

CASC4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV708323 1.0 ug DNA
EUR 374

CASC4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV708324 1.0 ug DNA
EUR 374

Polyclonal CASC4 Antibody (C-term)

APR03445G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CASC4 (C-term). This antibody is tested and proven to work in the following applications:

CASC4 sgRNA CRISPR Lentivector set (Human)

K0364501 3 x 1.0 ug
EUR 339

Casc4 sgRNA CRISPR Lentivector set (Mouse)

K4708701 3 x 1.0 ug
EUR 339

CASC4 sgRNA CRISPR Lentivector (Human) (Target 1)

K0364502 1.0 ug DNA
EUR 154

CASC4 sgRNA CRISPR Lentivector (Human) (Target 2)

K0364503 1.0 ug DNA
EUR 154

CASC4 sgRNA CRISPR Lentivector (Human) (Target 3)

K0364504 1.0 ug DNA
EUR 154

Casc4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4708702 1.0 ug DNA
EUR 154

Casc4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4708703 1.0 ug DNA
EUR 154

Casc4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4708704 1.0 ug DNA
EUR 154

Casc4 3'UTR GFP Stable Cell Line

TU153148 1.0 ml Ask for price

Casc4 3'UTR Luciferase Stable Cell Line

TU103148 1.0 ml Ask for price

Casc4 3'UTR Luciferase Stable Cell Line

TU201674 1.0 ml Ask for price

Casc4 3'UTR GFP Stable Cell Line

TU251674 1.0 ml Ask for price

CASC4 3'UTR GFP Stable Cell Line

TU053495 1.0 ml
EUR 2333

CASC4 3'UTR Luciferase Stable Cell Line

TU003495 1.0 ml
EUR 2333

CASC4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0364505 3 x 1.0 ug
EUR 376

Casc4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4708705 3 x 1.0 ug
EUR 376

CASC4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0364506 1.0 ug DNA
EUR 167

CASC4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0364507 1.0 ug DNA
EUR 167

CASC4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0364508 1.0 ug DNA
EUR 167

Casc4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4708706 1.0 ug DNA
EUR 167

Casc4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4708707 1.0 ug DNA
EUR 167

Casc4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4708708 1.0 ug DNA
EUR 167

dCas9-KRAB Lentiviral Vector

K203 10 ug
EUR 228

Cas9 Nuclease Lentiviral Vector

K002 10 ug
EUR 154

Cas9 Nickase Lentiviral Vector

K005 10 ug
EUR 154

pSMPUW-MNDnLacZ Lentiviral Control Vector

LTV-402 10 µg
EUR 618
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.

pLenti-GFP Lentiviral Control Vector

LTV-400 100 µL
EUR 618
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.

pSMPUW-Puro Lentiviral Expression Vector

VPK-212 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-Neo Lentiviral Expression Vector

VPK-213 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-Hygro Lentiviral Expression Vector

VPK-214 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pLenti-RFP-Puro Lentiviral Control Vector

LTV-403 100 µL
EUR 618
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.

pSMPUW-GFP-LC3 Lentiviral Expression Vector

LTV-801 10 µg
EUR 1204
Description: Expression vector contains a fusion of GFP and LC3. A separate GFP control vector is also included.

ESR1 Lentiviral Vector (Human) (pLenti-II)

LV010008 1.0 ug DNA
EUR 316

pSMPUW-GFP-Puro Lentiviral Control Vector

LTV-401 10 µg
EUR 618
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.

pSMPUW Universal Lentiviral Expression Vector (Promoterless)

VPK-211 10 µg
EUR 624
Description: Clone your gene of interest and a gene-specific promoter into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293T or 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-IRES-Puro Lentiviral Expression Vector

VPK-215 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-IRES-Neo Lentiviral Expression Vector

VPK-216 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-IRES-Hygro Lentiviral Expression Vector

VPK-217 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-IRES-Blasticidin Lentiviral Expression Vector

VPK-219 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

DPY19L1P2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723333 1.0 ug DNA Ask for price

DPY19L1P2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723334 1.0 ug DNA Ask for price

DRD5P1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723353 1.0 ug DNA Ask for price

DRD5P1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723357 1.0 ug DNA Ask for price

DRD5P1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723358 1.0 ug DNA Ask for price

DRD5P2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723359 1.0 ug DNA Ask for price

DRD5P2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723363 1.0 ug DNA Ask for price

DRD5P2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723364 1.0 ug DNA Ask for price

DSTNP1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723383 1.0 ug DNA Ask for price

DSTNP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723387 1.0 ug DNA Ask for price

DSTNP1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723388 1.0 ug DNA Ask for price

DSTNP3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723389 1.0 ug DNA Ask for price

DSTNP3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723393 1.0 ug DNA Ask for price

DSTNP3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723394 1.0 ug DNA Ask for price

DTX2P1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723395 1.0 ug DNA Ask for price

DTX2P1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723399 1.0 ug DNA Ask for price

DTX2P1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723400 1.0 ug DNA Ask for price

DURS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723401 1.0 ug DNA Ask for price

DURS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723405 1.0 ug DNA Ask for price

DURS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723406 1.0 ug DNA Ask for price

DUSPP Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723407 1.0 ug DNA Ask for price

DUSPP Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723411 1.0 ug DNA Ask for price

DUSPP Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723412 1.0 ug DNA Ask for price

DUTP1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723413 1.0 ug DNA Ask for price

DUTP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723417 1.0 ug DNA Ask for price

DUTP1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723418 1.0 ug DNA Ask for price

DUTP2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723419 1.0 ug DNA Ask for price

DUTP2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723423 1.0 ug DNA Ask for price

DUTP2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723424 1.0 ug DNA Ask for price

DUTP4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723425 1.0 ug DNA Ask for price

DUTP4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723429 1.0 ug DNA Ask for price

DUTP4 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723430 1.0 ug DNA Ask for price

DUTP5 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723431 1.0 ug DNA Ask for price

DUTP5 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723435 1.0 ug DNA Ask for price

DUTP5 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723436 1.0 ug DNA Ask for price

DUTP6 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723437 1.0 ug DNA Ask for price

DUTP6 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723441 1.0 ug DNA Ask for price

DUTP6 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723442 1.0 ug DNA Ask for price

DUTP7 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723443 1.0 ug DNA Ask for price

DUTP7 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723447 1.0 ug DNA Ask for price

DUTP7 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723448 1.0 ug DNA Ask for price

DUTP8 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723449 1.0 ug DNA Ask for price

DUTP8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723453 1.0 ug DNA Ask for price

DUTP8 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723454 1.0 ug DNA Ask for price

DUX4L8 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723455 1.0 ug DNA Ask for price

DUX4L8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723459 1.0 ug DNA Ask for price

Afterhyperpolarizations of PLTS cells had a shorter time to peak than these of LA cells. PLTS cells fired each Na(+)-dependent, persistent depolarization spikes and Ca(2+)-dependent, low-threshold spikes along with quick spikes. Low-threshold spikes in PLTS cells had been induced solely from hyperpolarized potentials. Both persistent depolarizations and low-threshold spikes may be evoked by synaptic activation. PLTS cells had been histochemically recognized as NADPH diaphorase-positive cells. As all NADPH diaphorase-positive cells in the identical tissue had been immunoreactive for nitric oxide (NO) synthase, PLTS cells had been thought of to launch NO. PLTS cells had the largest axonal fields.

Short-term synaptic plasticity.

Short-term synaptic plasticity.

Synaptic transmission is a dynamic course of. Postsynaptic responses wax and wane as presynaptic exercise evolves. This distinguished attribute of chemical synaptic transmission is an important determinant of the response properties of synapses and, in flip, of the stimulus properties chosen by neural networks and of the patterns of exercise generated by these networks. This evaluation focuses on synaptic modifications that outcome from prior exercise within the synapse below research, and is restricted to short-term results that final for at most a couple of minutes.

Forms of synaptic enhancement, equivalent to facilitation, augmentation, and post-tetanic potentiation, are normally attributed to results of a residual elevation in presynaptic [Ca(2+)]i, appearing on a number of molecular targets that seem like distinct from the secretory set off chargeable for quick exocytosis and phasic launch of transmitter to single motion potentials. We talk about the proof for this speculation, and the origins of the totally different kinetic phases of synaptic enhancement, in addition to the interpretation of statistical modifications in transmitter launch and roles performed by different elements equivalent to alterations in presynaptic Ca(2+) inflow or postsynaptic ranges of [Ca(2+)]i. Synaptic melancholy dominates enhancement at many synapses.

Depression is normally attributed to depletion of some pool of readily releasable vesicles, and numerous types of the depletion mannequin are mentioned. Depression may come up from suggestions activation of presynaptic receptors and from postsynaptic processes equivalent to receptor desensitization. In addition, glial-neuronal interactions can contribute to short-term synaptic plasticity. Finally, we summarize the current literature on putative molecular gamers in synaptic plasticity and the consequences of genetic manipulations and different modulatory influences.

Primary construction of the Aequorea victoria green-fluorescent protein.

Many cnidarians make the most of green-fluorescent proteins (GFPs) as energy-transfer acceptors in bioluminescence. GFPs fluoresce in vivo upon receiving vitality from both a luciferase-oxyluciferin excited-state advanced or a Ca(2+)-activated phosphoprotein. These extremely fluorescent proteins are distinctive because of the chemical nature of their chromophore, which is comprised of modified amino acid (aa) residues throughout the polypeptide. This report describes the cloning and sequencing of each cDNA and genomic clones of GFP from the cnidarian, Aequorea victoria.

The gfp10 cDNA encodes a 238-aa-residue polypeptide with a calculated Mr of 26,888. Comparison of A. victoria GFP genomic clones reveals three totally different restriction enzyme patterns which means that at the least three totally different genes are current within the A. victoria inhabitants at Friday Harbor, Washington. The gfp gene encoded by the lambda GFP2 genomic clone is comprised of at the least three exons unfold over 2.6 kb. The nucleotide sequences of the cDNA and the gene will help within the elucidation of structure-function relationships on this distinctive class of proteins.

Citations in CAS SciFinder to the rule-of-five (RO5) publication will exceed 1000 by year-end 2004. Trends within the RO5 literature explosion that may be discerned are the additional definitions of drug-like. This matter is explored when it comes to drug-like physicochemical options, drug-like structural options, a comparability of drug-like and non-drug-like in drug discovery and a dialogue of how drug-like options relate to medical success. Physicochemical options of CNS medicine and options associated to CNS blood-brain transporter affinity are briefly reviewed. Recent literature on options of non-oral medicine is reviewed and the way options of lead-like compounds differ from these of drug-like compounds is mentioned.

Short-term synaptic plasticity.

In vitro molecular mechanisms of bisphenol A motion.

Bisphenol A (BPA, 2,2-bis (4-hydroxyphenyl) propane; CAS# 80-05-7) is a chemical used primarily within the manufacture of polycarbonate plastic, epoxy resins and as a non-polymer additive to different plastics. Recent proof has demonstrated that human and wildlife populations are uncovered to ranges of BPA which trigger adversarial reproductive and developmental results in various totally different wildlife species and laboratory animal fashions. However, there are main uncertainties surrounding the spectrum of BPA’s mechanisms of motion, the tissue-specific impacts of exposures, and the essential home windows of susceptibility throughout which goal tissues are delicate to BPA exposures.

As a basis to handle a few of these uncertainties, this evaluation was ready by the “In vitro” professional sub-panel assembled in the course of the “Bisphenol A: An Examination of the Relevance of Ecological, In vitro and Laboratory Animal Studies for Assessing Risks to Human Health” workshop held in Chapel Hill, NC, Nov 28-29, 2006. The particular cost of this professional panel was to evaluation and assess the energy of the revealed literature pertaining to the mechanisms of BPA motion. The ensuing doc is an in depth evaluation of revealed research which have centered on the mechanistic foundation of BPA motion in various experimental fashions and an evaluation of the energy of the proof relating to the revealed BPA analysis.

In its present state, the database employs an easy-to-use, searchable interface for acquiring detailed information on the 109 at present recognized RNA modifications. Each entry gives the chemical construction, frequent identify and image, elemental composition and mass, CA registry numbers and index identify, phylogenetic supply, sort of RNA species wherein it’s discovered, and references to the primary reported construction willpower and synthesis. Though newly transferred in its entirety to The RNA Institute, the RNAMDB continues to develop with two notable additions, agmatidine and 8-methyladenosine, appended within the final 12 months.

CD28

MO28A(V25) 25 ug
EUR 50

CD28

MO28B(V100) 100 ug
EUR 50

CD28

MO28B(V25) 25 ug
EUR 50

CD28

MO28CFB(V100) 100 ug
EUR 50

CD28

MO28CFB(V25) 25 ug
EUR 50

CD28

MO28F(V100) 100 ug
EUR 50

CD28

MO28F(V25) 25 ug
EUR 50

CD28

MO28F(V500) 500 ug
EUR 50

CD28

MO28PE(V100) 100 ug
EUR 50

CD28

MO28PE(V25) 25 ug
EUR 50

CD28

MO28PP(V100) 100 ug
EUR 50

CD28

MO28PP(V25) 25 ug
EUR 50

CD28

MO28PP5.5(V100) 100 ug
EUR 50

CD28

MO28PP5.5(V25) 25 ug
EUR 50

CD28

MO28PU(V100) 100 ug
EUR 50

CD28

MO28PU(V500) 500 ug
EUR 50

CD28

PR27303 2 ug
EUR 191

Cd28/ Rat Cd28 ELISA Kit

ELI-02294r 96 Tests
EUR 886

CD28 antigen (CD28) polyclonal antibody

ABP-PAB-10144 100 ug Ask for price
    • Product line: Cell Surface Molecules / GPCRs
    • Brand:

pCDH-CuO-MCS-T2A-GFP co-inducible T2A lentivector

QM521A-1 10 ug
EUR 679
  • Category: Lentiviral Technology

pCDH-CuO-MCS-T2A-RFP co-inducible T2A lentivector

QM522A-1 10 ug
EUR 679
  • Category: Lentiviral Technology

CD28 antibody

10R-CD28bHU 100 ul
EUR 467
Description: Mouse monoclonal CD28 antibody

CD28 antibody

10R-CD28dCKp 500 ug
EUR 403
Description: Mouse monoclonal CD28 antibody

CD28 antibody

10R-CD28dMS 500 ug
EUR 370
Description: Hamster monoclonal CD28 antibody

CD28 antibody

10R-CD28eMS 500 ug
EUR 370
Description: Hamster monoclonal CD28 antibody

CD28 antibody

10R-6375 100 ug
EUR 192
Description: Syrian Hamster monoclonal CD28 antibody

CD28 antibody

10R-6376 100 ug
EUR 192
Description: Mouse monoclonal CD28 antibody

CD28 Antibody

46435-100ul 100ul
EUR 252

CD28 Antibody

1-CSB-PA005199
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CD28. Recognizes CD28 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CD28 antibody

70R-CR045 100 ug
EUR 300
Description: Affinity purified Rabbit polyclonal CD28 antibody

CD28 antibody

70R-49503 100 ul
EUR 287
Description: Purified Polyclonal CD28 antibody

CD28 antibody

70R-9669 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CD28 antibody

CD28/TP44

E21-D81 10ug
EUR 343

CD28 Antibody

AF0014 200ul
EUR 304
Description: CD28 antibody detects endogenous levels of CD28.

CD28 siRNA

20-abx900903
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD28 siRNA

20-abx910984
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD28 siRNA

20-abx910985
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CD28

YF-PA10780 50 ug
EUR 363
Description: Mouse polyclonal to CD28

T-cell-specific surface glycoprotein CD28/CD28

E21-I67 10ug
EUR 343

Recombinant Cynomolgus CD28 molecule/CD28(C-Fc)

CB24-10ug 10ug
EUR 100
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Cynomolgus CD28 molecule/CD28(C-Fc)

CB24-1mg 1mg
EUR 1115
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Cynomolgus CD28 molecule/CD28(C-Fc)

CB24-500ug 500ug
EUR 780
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Cynomolgus CD28 molecule/CD28(C-Fc)

CB24-50ug 50ug
EUR 202
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

pMy- BirA- T2A- eGFP

PVT10519 2 ug
EUR 301

pME-Cas9-T2A-GFP

PVT14646 2 ug
EUR 703

T2A-GFP Co-Expression HR Targeting Vector [T2A-GFP-pA-loxP-EF1?-RFP-T2A-Puro-pA-LoxP-MCS]

HR130PA-1 10 ug
EUR 1023
  • Category: HR Donors

CD28 Polyclonal Antibody

A1076-100
EUR 403

CD28 Blocking Peptide

33R-9340 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CD28 antibody, catalog no. 70R-9669

CD28 antibody (FITC)

61R-1069 50 ug
EUR 181
Description: Mouse monoclonal CD28 antibody (FITC)

CD28 antibody (PE)

61R-1231 200 ug
EUR 478
Description: Mouse monoclonal CD28 antibody (PE)

CD28 antibody (PE)

61R-1232 100 ug
EUR 349
Description: Syrian Hamster monoclonal CD28 antibody (PE)

CD28 antibody (biotin)

61R-1489 100 ug
EUR 316
Description: Syrian Hamster monoclonal CD28 antibody (biotin)

CD28 antibody (biotin)

61R-1490 100 ug
EUR 316
Description: Mouse monoclonal CD28 antibody (biotin)

CD28 antibody (allophycocyanin)

61R-1717 100 ug
EUR 478
Description: Syrian Hamster monoclonal CD28 antibody (allophycocyanin)

CD28 antibody (biotin)

61R-CD28dCKBT 500 ug
EUR 457
Description: Mouse monoclonal CD28 antibody (biotin)

CD28 antibody (FITC)

61R-CD28dCKFT 500 ug
EUR 565
Description: Mouse monoclonal CD28 antibody (FITC)

CD28 antibody (PE)

61R-CD28dCKPE 100 ug
EUR 349
Description: Mouse monoclonal CD28 antibody (PE)

CD28 antibody (Allophycocyanin)

61R-CD28dMSAPC 100 ug
EUR 457
Description: Hamster monoclonal CD28 antibody (Allophycocyanin)

CD28 antibody (biotin)

61R-CD28dMSBT 500 ug
EUR 435
Description: Hamster monoclonal CD28 antibody (biotin)

CD28 antibody (FITC)

61R-CD28dMSFT 500 ug
EUR 435
Description: Hamster monoclonal CD28 antibody (FITC)

CD28 antibody (PE)

61R-CD28dMSPE 200 ug
EUR 446
Description: Hamster monoclonal CD28 antibody (PE)

CD28 antibody (Allophycocyanin)

61R-CD28eMSAPC 100 ug
EUR 457
Description: Hamster monoclonal CD28 antibody (Allophycocyanin)

CD28 antibody (biotin)

61R-CD28eMSBT 500 ug
EUR 435
Description: Hamster monoclonal CD28 antibody (biotin)

CD28 antibody (FITC)

61R-CD28eMSFT 500 ug
EUR 435
Description: Hamster monoclonal CD28 antibody (FITC)

CD28 antibody (PE)

61R-CD28eMSPE 200 ug
EUR 446
Description: Hamster monoclonal CD28 antibody (PE)

CD28 Polyclonal Antibody

41651-100ul 100ul
EUR 252

CD28 Polyclonal Antibody

41651-50ul 50ul
EUR 187

CD28 antibody (Tyr218)

70R-33478 100 ug
EUR 327
Description: Rabbit polyclonal CD28 antibody (Tyr218)

CD28 (pT218) Antibody

20-abx009853
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Hamster CD28 Antibody

abx139999-01mg 0.1 mg
EUR 286
  • Shipped within 5-12 working days.

CD28 Blocking Peptide

AF0014-BP 1mg
EUR 195

CD28(204.12) Antibody

BNUB0164-100 100uL
EUR 209
Description: Primary antibody against CD28(204.12), Concentration: 0.2mg/mL

CD28(204.12) Antibody

BNUB0164-500 500uL
EUR 458
Description: Primary antibody against CD28(204.12), Concentration: 0.2mg/mL

CD28(CB28) Antibody

BNUB0384-100 100uL
EUR 209
Description: Primary antibody against CD28(CB28), Concentration: 0.2mg/mL

CD28(CB28) Antibody

BNUB0384-500 500uL
EUR 458
Description: Primary antibody against CD28(CB28), Concentration: 0.2mg/mL

CD28(204.12) Antibody

BNUM0164-50 50uL
EUR 395
Description: Primary antibody against CD28(204.12), 1mg/mL

CD28(CB28) Antibody

BNUM0384-50 50uL
EUR 395
Description: Primary antibody against CD28(CB28), 1mg/mL

CD28(204.12) Antibody

BNC040164-100 100uL
EUR 199
Description: Primary antibody against CD28(204.12), CF405S conjugate, Concentration: 0.1mg/mL

CD28(204.12) Antibody

BNC040164-500 500uL
EUR 544
Description: Primary antibody against CD28(204.12), CF405S conjugate, Concentration: 0.1mg/mL

CD28(CB28) Antibody

BNC040384-100 100uL
EUR 199
Description: Primary antibody against CD28(CB28), CF405S conjugate, Concentration: 0.1mg/mL

CD28(CB28) Antibody

BNC040384-500 500uL
EUR 544
Description: Primary antibody against CD28(CB28), CF405S conjugate, Concentration: 0.1mg/mL

CD28(204.12) Antibody

BNC610164-100 100uL
EUR 199
Description: Primary antibody against CD28(204.12), CF660R conjugate, Concentration: 0.1mg/mL

CD28(204.12) Antibody

BNC610164-500 500uL
EUR 544
Description: Primary antibody against CD28(204.12), CF660R conjugate, Concentration: 0.1mg/mL

CD28(CB28) Antibody

BNC610384-100 100uL
EUR 199
Description: Primary antibody against CD28(CB28), CF660R conjugate, Concentration: 0.1mg/mL

CD28(CB28) Antibody

BNC610384-500 500uL
EUR 544
Description: Primary antibody against CD28(CB28), CF660R conjugate, Concentration: 0.1mg/mL

CD28(204.12) Antibody

BNC470164-100 100uL
EUR 199
Description: Primary antibody against CD28(204.12), CF647 conjugate, Concentration: 0.1mg/mL

CD28(204.12) Antibody

BNC470164-500 500uL
EUR 544
Description: Primary antibody against CD28(204.12), CF647 conjugate, Concentration: 0.1mg/mL

CD28(CB28) Antibody

BNC470384-100 100uL
EUR 199
Description: Primary antibody against CD28(CB28), CF647 conjugate, Concentration: 0.1mg/mL

CD28(CB28) Antibody

BNC470384-500 500uL
EUR 544
Description: Primary antibody against CD28(CB28), CF647 conjugate, Concentration: 0.1mg/mL

CD28(204.12) Antibody

BNC550164-100 100uL
EUR 199
Description: Primary antibody against CD28(204.12), CF555 conjugate, Concentration: 0.1mg/mL

CD28(204.12) Antibody

BNC550164-500 500uL
EUR 544
Description: Primary antibody against CD28(204.12), CF555 conjugate, Concentration: 0.1mg/mL

CD28(CB28) Antibody

BNC550384-100 100uL
EUR 199
Description: Primary antibody against CD28(CB28), CF555 conjugate, Concentration: 0.1mg/mL

CD28(CB28) Antibody

BNC550384-500 500uL
EUR 544
Description: Primary antibody against CD28(CB28), CF555 conjugate, Concentration: 0.1mg/mL

CD28(204.12) Antibody

BNC050164-100 100uL
EUR 199
Description: Primary antibody against CD28(204.12), CF405M conjugate, Concentration: 0.1mg/mL

CD28(204.12) Antibody

BNC050164-500 500uL
EUR 544
Description: Primary antibody against CD28(204.12), CF405M conjugate, Concentration: 0.1mg/mL

CD28(CB28) Antibody

BNC050384-100 100uL
EUR 199
Description: Primary antibody against CD28(CB28), CF405M conjugate, Concentration: 0.1mg/mL

CD28(CB28) Antibody

BNC050384-500 500uL
EUR 544
Description: Primary antibody against CD28(CB28), CF405M conjugate, Concentration: 0.1mg/mL

CD28(204.12) Antibody

BNC400164-100 100uL
EUR 199
Description: Primary antibody against CD28(204.12), CF640R conjugate, Concentration: 0.1mg/mL

CD28(204.12) Antibody

BNC400164-500 500uL
EUR 544
Description: Primary antibody against CD28(204.12), CF640R conjugate, Concentration: 0.1mg/mL

CD28(CB28) Antibody

BNC400384-100 100uL
EUR 199
Description: Primary antibody against CD28(CB28), CF640R conjugate, Concentration: 0.1mg/mL

CD28(CB28) Antibody

BNC400384-500 500uL
EUR 544
Description: Primary antibody against CD28(CB28), CF640R conjugate, Concentration: 0.1mg/mL

CD28(204.12) Antibody

BNC430164-100 100uL
EUR 199
Description: Primary antibody against CD28(204.12), CF543 conjugate, Concentration: 0.1mg/mL

CD28(204.12) Antibody

BNC430164-500 500uL
EUR 544
Description: Primary antibody against CD28(204.12), CF543 conjugate, Concentration: 0.1mg/mL

CD28(CB28) Antibody

BNC430384-100 100uL
EUR 199
Description: Primary antibody against CD28(CB28), CF543 conjugate, Concentration: 0.1mg/mL

CD28(CB28) Antibody

BNC430384-500 500uL
EUR 544
Description: Primary antibody against CD28(CB28), CF543 conjugate, Concentration: 0.1mg/mL

CD28(204.12) Antibody

BNC800164-100 100uL
EUR 199
Description: Primary antibody against CD28(204.12), CF680 conjugate, Concentration: 0.1mg/mL

CD28(204.12) Antibody

BNC800164-500 500uL
EUR 544
Description: Primary antibody against CD28(204.12), CF680 conjugate, Concentration: 0.1mg/mL

CD28(CB28) Antibody

BNC800384-100 100uL
EUR 199
Description: Primary antibody against CD28(CB28), CF680 conjugate, Concentration: 0.1mg/mL

CD28(CB28) Antibody

BNC800384-500 500uL
EUR 544
Description: Primary antibody against CD28(CB28), CF680 conjugate, Concentration: 0.1mg/mL

CD28(204.12) Antibody

BNC810164-100 100uL
EUR 199
Description: Primary antibody against CD28(204.12), CF680R conjugate, Concentration: 0.1mg/mL

CD28(204.12) Antibody

BNC810164-500 500uL
EUR 544
Description: Primary antibody against CD28(204.12), CF680R conjugate, Concentration: 0.1mg/mL

CD28(CB28) Antibody

BNC810384-100 100uL
EUR 199
Description: Primary antibody against CD28(CB28), CF680R conjugate, Concentration: 0.1mg/mL

CD28(CB28) Antibody

BNC810384-500 500uL
EUR 544
Description: Primary antibody against CD28(CB28), CF680R conjugate, Concentration: 0.1mg/mL

CD28(204.12) Antibody

BNCP0164-250 250uL
EUR 383
Description: Primary antibody against CD28(204.12), PerCP conjugate, Concentration: 0.1mg/mL

CD28(CB28) Antibody

BNCP0384-250 250uL
EUR 383
Description: Primary antibody against CD28(CB28), PerCP conjugate, Concentration: 0.1mg/mL

CD28(204.12) Antibody

BNCR0164-250 250uL
EUR 383
Description: Primary antibody against CD28(204.12), RPE conjugate, Concentration: 0.1mg/mL

CD28(CB28) Antibody

BNCR0384-250 250uL
EUR 383
Description: Primary antibody against CD28(CB28), RPE conjugate, Concentration: 0.1mg/mL

CD28(204.12) Antibody

BNCA0164-250 250uL
EUR 383
Description: Primary antibody against CD28(204.12), APC conjugate, Concentration: 0.1mg/mL

CD28(CB28) Antibody

BNCA0384-250 250uL
EUR 383
Description: Primary antibody against CD28(CB28), APC conjugate, Concentration: 0.1mg/mL

CD28(204.12) Antibody

BNCAP0164-100 100uL
EUR 199
Description: Primary antibody against CD28(204.12), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD28(204.12) Antibody

BNCAP0164-500 500uL
EUR 544
Description: Primary antibody against CD28(204.12), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD28(CB28) Antibody

BNCAP0384-100 100uL
EUR 199
Description: Primary antibody against CD28(CB28), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD28(CB28) Antibody

BNCAP0384-500 500uL
EUR 544
Description: Primary antibody against CD28(CB28), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD28(204.12) Antibody

BNCH0164-100 100uL
EUR 199
Description: Primary antibody against CD28(204.12), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD28(204.12) Antibody

BNCH0164-500 500uL
EUR 544
Description: Primary antibody against CD28(204.12), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD28(CB28) Antibody

BNCH0384-100 100uL
EUR 199
Description: Primary antibody against CD28(CB28), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD28(CB28) Antibody

BNCH0384-500 500uL
EUR 544
Description: Primary antibody against CD28(CB28), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD28(204.12) Antibody

BNC940164-100 100uL
EUR 199
Description: Primary antibody against CD28(204.12), CF594 conjugate, Concentration: 0.1mg/mL

CD28(204.12) Antibody

BNC940164-500 500uL
EUR 544
Description: Primary antibody against CD28(204.12), CF594 conjugate, Concentration: 0.1mg/mL

CD28(CB28) Antibody

BNC940384-100 100uL
EUR 199
Description: Primary antibody against CD28(CB28), CF594 conjugate, Concentration: 0.1mg/mL

CD28(CB28) Antibody

BNC940384-500 500uL
EUR 544
Description: Primary antibody against CD28(CB28), CF594 conjugate, Concentration: 0.1mg/mL

CD28(204.12) Antibody

BNC700164-100 100uL
EUR 199
Description: Primary antibody against CD28(204.12), CF770 conjugate, Concentration: 0.1mg/mL

CD28(204.12) Antibody

BNC700164-500 500uL
EUR 544
Description: Primary antibody against CD28(204.12), CF770 conjugate, Concentration: 0.1mg/mL

CD28(CB28) Antibody

BNC700384-100 100uL
EUR 199
Description: Primary antibody against CD28(CB28), CF770 conjugate, Concentration: 0.1mg/mL

CD28(CB28) Antibody

BNC700384-500 500uL
EUR 544
Description: Primary antibody against CD28(CB28), CF770 conjugate, Concentration: 0.1mg/mL

The RNA Modification Database is staying up-to-date with important enhancements being ready for inclusion throughout the subsequent 12 months and the next 12 months. The expanded future position of The RNA Modification Database shall be to function a major info portal for researchers throughout the whole spectrum of RNA-related analysis. Most not too long ago, partly pushed by NIH roadmap initiatives, issues have arisen as to what tool-like means within the seek for chemical instruments to probe biology house.