The CERHR Expert Panel on Bisphenol A accomplished its analysis in August 2007.

ASH sensory neurons are required in Caenorhabditis elegans for a wide range of avoidance behaviors in response to chemical repellents, high osmotic solutions and nose touch. The ASH neurons are therefore hypothesized to be polymodal nociceptive neurons. To understand the nature of polymodal sensory response and adaptation at the cellular level, we expressed the calcium indicator protein cameleon in ASH and analyzed intracellular Ca(2+) responses following stimulation with chemical repellents, osmotic shock and nose touch. We found that a variety of noxious stimuli evoked strong responses in ASH including quinine, denatonium, detergents, heavy metals, both hyper- and hypo-osmotic shock and nose touch. We observed that repeated chemical stimulation led to a reversible reduction in the magnitude of the sensory response, indicating that adaptation occurs within the ASH sensory neuron. A key component of ASH adaptation is GPC-1, a G-protein gamma-subunit expressed specifically in chemosensory neurons. We hypothesize that G-protein gamma-subunit heterogeneity provides a mechanism for repellent-specific adaptation, which could facilitate discrimination of a variety of repellents by these polymodal sensory neurons.

The National Toxicology Program (NTP) Center for the Evaluation of Risks to Human Reproduction (CERHR) carried out an analysis of the potential for bisphenol A to trigger opposed results on copy and growth in people. The CERHR Expert Panel on Bisphenol A accomplished its analysis in August 2007. CERHR chosen bisphenol A for analysis as a result of of the: widespread human publicity; public concern for doable well being results from human exposures; high manufacturing quantity; proof of reproductive and developmental toxicity in laboratory animal research Bisphenol A (CAS RN: 80-05-7) is a high manufacturing quantity chemical used primarily in the manufacturing of polycarbonate plastics and epoxy resins.

Polycarbonate plastics are used in some meals and drink containers; the resins are used as lacquers to coat steel merchandise similar to meals cans, bottle tops, and water provide pipes. To a lesser extent bisphenol A is used in the manufacturing of polyester resins, polysulfone resins, polyacrylate resins, and flame retardants. In addition, bisphenol A is used in the processing of polyvinyl chloride plastic and in the recycling of thermal paper. Some polymers used in dental sealants and tooth coatings comprise bisphenol A. The major supply of publicity to bisphenol A for most individuals is assumed to happen via the food regimen.

While air, mud, and water (including pores and skin contact throughout bathing and swimming) are different doable sources of publicity, bisphenol A in meals and drinks accounts for the majority of each day human publicity. The highest estimated each day intakes of bisphenol A in the common inhabitants happen in infants and youngsters. The outcomes of this bisphenol A analysis are printed in an NTP-CERHR Monograph that consists of the (1) NTP Brief and (2) Expert Panel Report on the Reproductive and Developmental Toxicity of Bisphenol A. Additional info associated to the analysis course of, including the peer overview report for the NTP Brief and public feedback acquired on the draft NTP Brief and the closing knowledgeable panel report.

See bisphenol A below “CERHR Chemicals” on the homepage. The NTP reached the following conclusions on the doable results of publicity to bisphenol A on human growth and copy. Note that the doable ranges of concern, from lowest to highest, are negligible concern, minimal concern, some concern, concern, and critical concern. The NTP has some concern for results on the mind, habits, and prostate gland in fetuses, infants, and youngsters at present human exposures to bisphenol A. The NTP has minimal concern for results on the mammary gland and an earlier age for puberty for females in fetuses, infants, and youngsters at present human exposures to bisphenol A.

The NTP has negligible concern that publicity of pregnant girls to bisphenol A will outcome in fetal or neonatal mortality, beginning defects, or lowered beginning weight and development in their offspring. The NTP has negligible concern that publicity to bisphenol A will trigger reproductive results in non-occupationally uncovered adults and minimal concern for staff uncovered to larger ranges in occupational settings.

Myocardial calcium and magnesium in acute ischemic damage.

The impact of ischemic damage on calcium and magnesium distribution in canine myocardial cells was investigated in tissue broken by occlusion of the circumflex department of the left coronary artery for 60 minutes or for 40 minutes adopted by 20 minutes of reperfusion of the broken tissue by arterial blood. No vital change in the focus of these cations was famous in completely ischemic, irreversibly injured myocardial cells, however tissue calcium was markedly elevated in cells killed by an episode of transient ischemia. Tissue water and sodium additionally have been elevated and magnesium was decreased considerably in the transient ischemia mannequin.

Investigation of the localization of the elevated Ca(–) by cellular fractionation and chemical evaluation in addition to by electron miscroscopy and microincineration confirmed that a lot of it was localized in dense our bodies within the mitochondria. Within the intramitochondrial dense our bodies, the calcium appeared to be a precipitate of an as but undefined kind of calcium phosphate. Dormant Bacillus subtilis spores can be induced to germinate by vitamins, in addition to by nonmetabolizable chemical compounds, similar to a 1:1 chelate of Ca(2+) and dipicolinic acid (DPA).

Nutrients bind receptors in the spore, and this binding triggers occasions in the spore core, including DPA excretion and rehydration, and additionally prompts hydrolysis of the surrounding cortex via mechanisms that are largely unknown. As Ca(2+)-DPA doesn’t require receptors to induce spore germination, we requested if this course of makes use of different proteins, similar to the putative cortex-lytic enzymes SleB and CwlJ, that are concerned in nutrient-induced germination.

ASH sensory neurons are required in Caenorhabditis elegans for a wide range of avoidance behaviors in response to chemical repellents, high osmotic solutions and nose touch. The ASH neurons are therefore hypothesized to be polymodal nociceptive neurons. To understand the nature of polymodal sensory response and adaptation at the cellular level, we expressed the calcium indicator protein cameleon in ASH and analyzed intracellular Ca(2+) responses following stimulation with chemical repellents, osmotic shock and nose touch. We found that a variety of noxious stimuli evoked strong responses in ASH including quinine, denatonium, detergents, heavy metals, both hyper- and hypo-osmotic shock and nose touch. We observed that repeated chemical stimulation led to a reversible reduction in the magnitude of the sensory response, indicating that adaptation occurs within the ASH sensory neuron. A key component of ASH adaptation is GPC-1, a G-protein gamma-subunit expressed specifically in chemosensory neurons. We hypothesize that G-protein gamma-subunit heterogeneity provides a mechanism for repellent-specific adaptation, which could facilitate discrimination of a variety of repellents by these polymodal sensory neurons.

The transient receptor potential channel TRPA1: from gene to pathophysiology.

The Transient Receptor Potential Ankyrin 1 channel (TRPA1), is a member of the massive TRP household of ion channels, and features as a Ca(2+) permeable non-selective cation channel in many alternative cell processes, starting from sensory to homeostatic duties. TRPA1 is extremely conserved throughout the animal kingdom. The solely mammalian TRPA subfamily member, TRPA1, is extensively expressed in neuronal (e.g. sensory dorsal root and trigeminal ganglia neurons)- and in non-neuronal cells (e.g. epithelial cells, hair cells). It reveals 14-19 amino-(N-)terminal ankyrin repeats, an uncommon structural function.

Caspase-8 IETD-R110 Fluorometric and Colorimetric Assay Kit (25 assays)
30011-1 1KIT
EUR 204
Description: Minimum order quantity: 1 unit of 1KIT
Caspase-5 Fluorometric Assay Kit
K2195-25 25 assays
EUR 238
Caspase-4 Fluorometric Assay Kit
K2198-25 25 assays
EUR 251
Caspase-8 Fluorometric Assay Kit
K2012-25 25 assays
EUR 238
Caspase-2 Fluorometric Assay Kit
K2016-25 25 assays
EUR 238
Caspase-9 Fluorometric Assay Kit
K2018-25 25 assays
EUR 238
Caspase-12 Fluorometric Assay Kit
K2150-25 25 assays
EUR 251
Caspase-2 Fluorometric Assay Kit
EUR 202
Caspase-9 Fluorometric Assay Kit
EUR 207
Caspase-3 Fluorometric Assay Kit
K2007-25 25 assays
EUR 238
Caspase-1 Fluorometric Assay Kit
K2010-25 25 assays
EUR 238
Caspase-3 Fluorometric Assay Kit
EUR 207
Caspase-10 Fluorometric Assay Kit
EUR 202
Caspase-4 Fluorometric Assay Kit
EUR 213
Caspase-12 Fluorometric Assay Kit
EUR 256
Caspase-5 Fluorometric Assay Kit
EUR 202
Caspase-1 Fluorometric Assay Kit
EUR 207
Caspase-8 Fluorometric Assay Kit
EUR 207
Caspase 6 Fluorometric Assay Kit
55R-1276 25 assays
EUR 287
Description: Assay Kit for detection of Capase 6 activity in the research laboratory
Caspase-6 Fluorometric Assay Kit
K2014-100 100 assays
EUR 474
Caspase-6 Fluorometric Assay Kit
K2014-200 200 assays
EUR 696
Caspase-6 Fluorometric Assay Kit
K2014-400 400 assays
EUR 1086
Caspase-6 Fluorometric Assay Kit
EUR 430
Caspase-6 Fluorometric Assay Kit
EUR 615
Caspase-6 Fluorometric Assay Kit
EUR 958
Caspase-6 Colorimetric Assay Kit
K2015-25 25 assays
EUR 238
Caspase-6 Colorimetric Assay Kit
EUR 202
30008-1 1KIT
EUR 204
Description: Minimum order quantity: 1 unit of 1KIT
Caspase-3 DEVD-R110 Fluorometric and Colorimetric Assay Kit (100 assays)
30008-2 1KIT
EUR 383
Description: Minimum order quantity: 1 unit of 1KIT
Caspase-8 IETD-R110 Fluorometric and Colorimetric Assay Kit (100 assays)
30011-2 1KIT
EUR 383
Description: Minimum order quantity: 1 unit of 1KIT
Caspase 3 Fluorometric Assay Kit
55R-1269 25 assays
EUR 277
Description: Assay Kit for detection of Capase 3 activity in the research laboratory
Caspase 1 Fluorometric Assay Kit
55R-1272 25 assays
EUR 277
Description: Assay Kit for detection of Capase 1 activity in the research laboratory
Caspase 8 Fluorometric Assay Kit
55R-1274 25 assays
EUR 277
Description: Assay Kit for detection of Capase 8 activity in the research laboratory
Caspase 2 Fluorometric Assay Kit
55R-1278 25 assays
EUR 284
Description: Assay Kit for detection of Capase 2 activity in the research laboratory
Caspase 9 Fluorometric Assay Kit
55R-1280 25 assays
EUR 277
Description: Assay Kit for detection of Capase 9 activity in the research laboratory
Caspase 5 Fluorometric Assay Kit
55R-1282 25 assays
EUR 284
Description: Assay Kit for detection of Capase 5 activity in the research laboratory
Caspase 10 Fluorometric Assay Kit
55R-1284 25 assays
EUR 284
Description: Assay Kit for detection of Capase 10 activity in the research laboratory
Caspase 4 Fluorometric Assay Kit
55R-1286 25 assays
EUR 303
Description: Assay Kit for detection of Capase 4 activity in the research laboratory
Caspase-5 Fluorometric Assay Kit
K2195-100 100 assays
EUR 502
Caspase-5 Fluorometric Assay Kit
K2195-200 200 assays
EUR 696
Caspase-5 Fluorometric Assay Kit
K2195-400 400 assays
EUR 1114
Caspase-4 Fluorometric Assay Kit
K2198-100 100 assays
EUR 529
Caspase-4 Fluorometric Assay Kit
K2198-200 200 assays
EUR 738
Caspase-4 Fluorometric Assay Kit
K2198-400 400 assays
EUR 1114
Caspase-8 Fluorometric Assay Kit
K2012-100 100 assays
EUR 474
Caspase-8 Fluorometric Assay Kit
K2012-200 200 assays
EUR 696
Caspase-8 Fluorometric Assay Kit
K2012-400 400 assays
EUR 1086
Caspase-2 Fluorometric Assay Kit
K2016-100 100 assays
EUR 502
Caspase-2 Fluorometric Assay Kit
K2016-200 200 assays
EUR 696
Caspase-2 Fluorometric Assay Kit
K2016-400 400 assays
EUR 1114
Caspase-9 Fluorometric Assay Kit
K2018-100 100 assays
EUR 502
Caspase-9 Fluorometric Assay Kit
K2018-200 200 assays
EUR 669
Caspase-9 Fluorometric Assay Kit
K2018-400 400 assays
EUR 1114
Caspase-12 Fluorometric Assay Kit
K2150-100 100 assays
EUR 529
Caspase-2 Fluorometric Assay Kit
EUR 463
Caspase-2 Fluorometric Assay Kit
EUR 615
Caspase-2 Fluorometric Assay Kit
EUR 958
Caspase-9 Fluorometric Assay Kit
EUR 468
Caspase-9 Fluorometric Assay Kit
EUR 615
Caspase-9 Fluorometric Assay Kit
EUR 958
Caspase-3 Fluorometric Assay Kit
K2007-100 100 assays
EUR 474
Caspase-3 Fluorometric Assay Kit
K2007-200 200 assays
EUR 696
Caspase-3 Fluorometric Assay Kit
K2007-400 400 assays
EUR 1086
Caspase-1 Fluorometric Assay Kit
K2010-100 100 assays
EUR 474
Caspase-1 Fluorometric Assay Kit
K2010-200 200 assays
EUR 696
Caspase-1 Fluorometric Assay Kit
K2010-400 400 assays
EUR 1086
Caspase-3 Fluorometric Assay Kit
EUR 479
Caspase-3 Fluorometric Assay Kit
EUR 620
Caspase-3 Fluorometric Assay Kit
EUR 979
Caspase-10 Fluorometric Assay Kit
EUR 441
Caspase-10 Fluorometric Assay Kit
EUR 615
Caspase-10 Fluorometric Assay Kit
EUR 958
Caspase-4 Fluorometric Assay Kit
EUR 468
Caspase-4 Fluorometric Assay Kit
EUR 615
Caspase-4 Fluorometric Assay Kit
EUR 925
Caspase-12 Fluorometric Assay Kit
EUR 501
Caspase-5 Fluorometric Assay Kit
EUR 436
Caspase-5 Fluorometric Assay Kit
EUR 582
Caspase-5 Fluorometric Assay Kit
EUR 958
Caspase-1 Fluorometric Assay Kit
EUR 479
Caspase-1 Fluorometric Assay Kit
EUR 620
Caspase-1 Fluorometric Assay Kit
EUR 958
Caspase-8 Fluorometric Assay Kit
EUR 479
Caspase-8 Fluorometric Assay Kit
EUR 615
Caspase-8 Fluorometric Assay Kit
EUR 958
Caspase 6 Assay Kit
  • EUR 1302.00
  • EUR 582.00
  • 100 tests
  • 25 tests
  • Shipped within 1 week.
Caspase-3 Activity Assay Kit II (Fluorometric)
EUR 512
Glucose-6-Phosphate Fluorometric Assay Kit
K2220-100 100 assays
EUR 599
Fructose-6-Phosphate Fluorometric Assay Kit
K2222-100 100 assays
EUR 599
Caspase Fluorometric Substrate Set
EUR 544
Caspase-5 Colorimetric Assay Kit
K2196-25 25 assays
EUR 251
Caspase-10 Colorimetric Assay Kit
K2197-25 25 assays
EUR 251
Caspase-4 Colorimetric Assay Kit
K2199-25 25 assays
EUR 266
Caspase-8 Colorimetric Assay Kit
K2013-25 25 assays
EUR 238
Caspase-2 Colorimetric Assay Kit
K2017-25 25 assays
EUR 251
Caspase-9 Colorimetric Assay Kit
K2019-25 25 assays
EUR 251
Caspase-8 Colorimetric Assay Kit
EUR 207
Caspase-2 Colorimetric Assay Kit
EUR 213

The TRPA1 channel is activated by noxious chilly (<17 °C) in addition to by a plethora of chemical compounds that consists of not solely electrophilic compounds and oxidants that can modify, in an alkylative or oxidative vogue, nucleophilic cysteine residues in the channel’s N-terminus, but in addition compounds that don’t covalently bind to the channel proteins (e.g. menthol, nifedipin). Based on localization and purposeful properties, TRPA1 is thought-about a key participant in acute and power (neuropathic) ache and irritation. Moreover, its position in the (patho)physiology of practically all organ methods is anticipated, and will be mentioned alongside with the potential of TRPA1 as a drug goal for the administration of numerous pathological circumstances.

Using chemical shift perturbation to characterise ligand binding.

Using chemical shift perturbation to characterise ligand binding.

Chemical shift perturbation (CSP, chemical shift mapping or complexation-induced modifications in chemical shift, CIS) follows modifications within the chemical shifts of a protein when a ligand is added, and makes use of these to decide the placement of the binding web site, the affinity of the ligand, and/or presumably the construction of the advanced. A key consider figuring out the looks of spectra throughout a titration is the change price between free and certain, or extra particularly the off-rate koff. When koff is bigger than the chemical shift distinction between free and certain, which generally equates to an affinity Kd weaker than about 3μM, then change is quick on the chemical shift timescale.

Under these circumstances, the noticed shift is the population-weighted common of free and certain, which permits Kd to be decided from measurement of peak positions, offered the measurements are made appropriately. (1)H shifts are influenced to a big extent by through-space interactions, whereas (13) and (13)Cβ shifts are influenced extra by through-bond results. (15)N and (13)C’ shifts are influenced each by through-bond and by through-space (hydrogen bonding) interactions. For figuring out the placement of a certain ligand on the idea of shift change, probably the most acceptable methodology is subsequently normally to measure (15)N HSQC spectra, calculate the geometrical distance moved by the height, weighting (15)N shifts by an element of about 0.14 in contrast to (1)H shifts, and choose these residues for which the weighted shift change is bigger than the usual deviation of the shift for all residues.

Other strategies are mentioned, particularly the measurement of (13)CH3 indicators. Slow to intermediate change charges lead to line broadening, and make Kd values very troublesome to acquire. There isn’t any great way to distinguish modifications in chemical shift due to direct binding of the ligand from modifications in chemical shift due to allosteric change. Ligand binding at a number of websites can typically be characterised, by simultaneous becoming of many measured shift modifications, or extra just by including substoichiometric quantities of ligand. The chemical shift modifications can be utilized as restraints for docking ligand onto protein. By use of quantitative calculations of ligand-induced chemical shift modifications, it’s changing into potential to decide not simply the place but in addition the orientation of ligands.

Glutamate and neurotrophic elements in neuronal plasticity and illness.

Glutamate’s position as a neurotransmitter at synapses has been recognized for 40 years, however glutamate has since been proven to regulate neurogenesis, neurite outgrowth, synaptogenesis, and neuron survival within the creating and grownup mammalian nervous system. Cell-surface glutamate receptors are coupled to Ca(2+) inflow and launch from endoplasmic reticulum shops, which causes speedy (kinase- and protease-mediated) and delayed (transcription-dependent) responses that change the construction and performance of neurons. Neurotrophic elements and glutamate work together to regulate developmental and grownup neuroplasticity. For instance, glutamate stimulates the manufacturing of brain-derived neurotrophic issue (BDNF), which, in flip, modifies neuronal glutamate sensitivity, Ca(2+) homeostasis, and plasticity.

Neurotrophic elements could modify glutamate signaling straight, by altering the expression of glutamate receptor subunits and Ca(2+)-regulating proteins, and likewise not directly by inducing the manufacturing of antioxidant enzymes, energy-regulating proteins, and antiapoptotic Bcl-2 relations. Excessive activation of glutamate receptors, beneath situations of oxidative and metabolic stress, could contribute to neuronal dysfunction and degeneration in ailments starting from stroke and Alzheimer’s illness to psychiatric issues. By enhancing neurotrophic issue signaling, environmental elements comparable to train and dietary vitality restriction, and chemical compounds comparable to antidepressants could optimize glutamatergic signaling and shield in opposition to neurological issues.

Using chemical shift perturbation to characterise ligand binding.

Glial cells in (patho)physiology.

Neuroglial cells outline mind homeostasis and mount protection in opposition to pathological insults. Astroglia regulate neurogenesis and improvement of mind circuits. In the grownup mind, astrocytes enter into intimate dynamic relationship with neurons, particularly at synaptic websites the place they functionally kind the tripartite synapse. At these websites, astrocytes regulate ion and neurotransmitter homeostasis, metabolically help neurons and monitor synaptic exercise; one of many readouts of the latter manifests in astrocytic intracellular Ca(2+) indicators. This type of astrocytic excitability can lead to launch of chemical transmitters by way of Ca(2+) -dependent exocytosis.

Once within the extracellular area, gliotransmitters can modulate synaptic plasticity and trigger modifications in habits. Besides these physiological duties, astrocytes are elementary for development and final result of neurological ailments. In Alzheimer’s illness, for instance, astrocytes could contribute to the etiology of this dysfunction. Highly deadly glial-derived tumors use signaling trickery to coerce regular mind cells to help tumor invasiveness. This evaluation not solely sheds new gentle on the mind operation in well being and illness, but in addition factors to many unknowns.

Caspase 5 p10 antibody

70R-49464 100 ul
EUR 244
Description: Purified Polyclonal Caspase 5 p10 antibody

Caspase 14 p10 antibody

70R-50903 100 ul
EUR 244
Description: Purified Polyclonal Caspase 14 p10 antibody

Caspase 14 p10 Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Caspase 5 p10 Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Caspase 1 (p10, Cleaved-Ala317) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Cleaved Caspase-1 (Arg317) /P10 Antibody

AF4022 200ul
EUR 376
Description: Caspase 1 (p10,Cleaved-Arg317) Antibody detects endogenous levels of fragment of activated Caspase 1 resulting from cleavage adjacent to Arg317.

Anti-Caspase-1(P10)/CASP1 Antibody

PA1522 100ug/vial
EUR 334

Caspase 1 p10 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Caspase 14 (p10, Cleaved-Lys222) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Caspase 5 (p10, Cleaved-Ser331) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Anti-Caspase-3 (P10)/CASP3 Antibody

PA1302 100ug/vial
EUR 294

Anti-Caspase-3 (P10)/CASP3 Antibody

PA1302-2 100ug/vial
EUR 334

Anti-Caspase-8(P10)/CASP8 Antibody

PA1524 100ug/vial
EUR 334

Caspase 14 p10 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Caspase 5 p10 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Cleaved Caspase-1 (Arg317) /P10 Blocking Peptide

AF4022-BP 1mg
EUR 195

Cleaved-Caspase-5 p10 (S331) Polyclonal Antibody

40509-100ul 100ul
EUR 252

Cleaved-Caspase-5 p10 (S331) Polyclonal Antibody

40509-50ul 50ul
EUR 187

Cleaved-Caspase-5 p10 (S331) Polyclonal Antibody

ABP50021-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human Caspase-5 p10 at AA range: 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of Cleaved-Caspase-5 p10 S331) from Human. This Cleaved-Caspase-5 p10 S331) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Caspase-5 p10 at AA range: 290-370

Cleaved-Caspase-5 p10 (S331) Polyclonal Antibody

ABP50021-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human Caspase-5 p10 at AA range: 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of Cleaved-Caspase-5 p10 S331) from Human. This Cleaved-Caspase-5 p10 S331) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Caspase-5 p10 at AA range: 290-370

Cleaved-Caspase-5 p10 (S331) Polyclonal Antibody

ABP50021-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human Caspase-5 p10 at AA range: 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of Cleaved-Caspase-5 p10 S331) from Human. This Cleaved-Caspase-5 p10 S331) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Caspase-5 p10 at AA range: 290-370

Cleaved-Caspase-5 p10 (S331) Polyclonal Antibody

ES1020-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Cleaved-Caspase-5 p10 (S331) from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Cleaved-Caspase-5 p10 (S331) Polyclonal Antibody

ES1020-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Cleaved-Caspase-5 p10 (S331) from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-Cleaved-Caspase-5 p10 (S331) antibody

STJ90029 200 µl
EUR 197
Description: Rabbit polyclonal to Cleaved-Caspase-5 p10 (S331).

Anti-Caspase-1(P20)/CASP1 Antibody

PA1440-1 100ug/vial
EUR 294

Anti-Caspase-2/CASP2 Antibody

A02384-1 100ug/vial
EUR 334

Anti-Caspase 4/CASP4 Antibody

A02941-1 100ug/vial
EUR 334

Anti-Caspase 8/CASP8 Antibody

A00042-1 100ug/vial
EUR 294

Anti-Caspase-6(P18)/CASP6 Antibody

PA1441-1 100ug/vial
EUR 334

Anti-Caspase-3(P17)/CASP3 Antibody

PA1961-1 100ug/vial
EUR 334

Anti-Caspase-8 Rabbit Monoclonal Antibody

M00042-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Caspase-8 Antibody. Validated in IF, WB and tested in Human.

Anti-Caspase-7 Rabbit Monoclonal Antibody

M01044-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Caspase-7 Antibody. Validated in IP, WB and tested in Mouse, Rat.

Anti-Caspase-10 Rabbit Monoclonal Antibody

M02190-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Caspase-10 Antibody. Validated in IP, WB and tested in Human.

Anti-Caspase-2 Rabbit Monoclonal Antibody

M02384-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Caspase-2 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.

3-D Life RGD Peptide

P10-3 3x 1 µmol
EUR 276

Caspase-1 Antibody

EUR 403

Caspase-1 Antibody

EUR 146

Caspase-1 Antibody

24290-100ul 100ul
EUR 390

Caspase-1 Antibody

24291-100ul 100ul
EUR 390

Caspase 1 antibody

20R-1427 100 ug
EUR 651
Description: Rabbit polyclonal Caspase 1 antibody

Caspase 1 antibody

70R-11561 100 ug
EUR 527
Description: Rabbit polyclonal Caspase 1 antibody

Caspase 1 antibody

70R-31086 100 ug
EUR 327
Description: Rabbit polyclonal Caspase 1 antibody

Caspase 1 antibody

70R-31087 100 ug
EUR 327
Description: Rabbit polyclonal Caspase 1 antibody

Caspase 1 antibody

70R-31116 100 ug
EUR 327
Description: Rabbit polyclonal Caspase 1 antibody

Caspase 1 Antibody

EUR 338

Caspase 1 Antibody

EUR 146

Caspase 1 antibody

70R-13979 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal Caspase 1 antibody

Caspase 1 antibody

70R-14061 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal Caspase 1 antibody

Caspase 1 antibody

70R-15367 100 ug
EUR 327
Description: Rabbit polyclonal Caspase 1 antibody

caspase 1 Antibody

39310-100ul 100ul
EUR 390

Caspase-1 Antibody

48847-100ul 100ul
EUR 333

Caspase-1 Antibody

48847-50ul 50ul
EUR 239

Caspase 1 antibody

70R-35920 100 ug
EUR 327
Description: Rabbit polyclonal Caspase 1 antibody

Caspase 1 antibody

70R-49451 100 ul
EUR 244
Description: Purified Polyclonal Caspase 1 antibody

Caspase 1 antibody

70R-49452 100 ul
EUR 244
Description: Purified Polyclonal Caspase 1 antibody

Caspase 1 antibody

70R-51474 100 ul
EUR 244
Description: Purified Polyclonal Caspase 1 antibody

Caspase 1 Antibody

AF5418 200ul
EUR 304
Description: Caspase 1 Antibody detects endogenous levels of total Caspase 1.

Caspase 1 Antibody

ABF5418 100 ug
EUR 438

Caspase 1 antibody

PAab10015 100 ug
EUR 386

Anti-pro Caspase 9 Rabbit Monoclonal Antibody

M00080-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal pro Caspase 9 Antibody. Validated in WB and tested in Human.

Anti-pro Caspase 3 Rabbit Monoclonal Antibody

M00334-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal pro Caspase 3 Antibody. Validated in IP, IF, WB and tested in Human, Mouse.

Anti-Caspase-6 p18 Rabbit Monoclonal Antibody

M02631-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Caspase-6 p18 Antibody. Validated in IP, WB and tested in Human.

Caspase-3/7 Inhibitor

EUR 153

Caspase Inhibitor Set I

A9901-1 1 Set
EUR 154

Caspase-3/7 Inhibitor I

A1925-1 1 mg
EUR 148
Description: Caspase-3/7 inbibitor I is a potent, reversible, isatin sulfonamide-based inhibitor of caspase-3 (KI(app) = 60 nM) and caspase-7 (KI(app) = 170 nM). Is a weaker inhibitor of caspase-9 (Ki(app) = 3.1 mM).

Cleaved-Caspase-1 Antibody

EUR 338

Caspase 1 antibody (HRP)

60R-1915 100 ug
EUR 327
Description: Rabbit polyclonal Caspase 1 antibody (HRP)

Caspase 1 antibody (FITC)

60R-1916 100 ug
EUR 327
Description: Rabbit polyclonal Caspase 1 antibody (FITC)

Caspase 1 antibody (biotin)

60R-1917 100 ug
EUR 327
Description: Rabbit polyclonal Caspase 1 antibody (biotin)

Caspase 1 antibody (Ser376)

70R-35444 100 ug
EUR 327
Description: Purified Rabbit polyclonal Caspase 1 antibody (Ser376)

Caspase 1 p20 antibody

70R-49453 100 ul
EUR 244
Description: Purified Polyclonal Caspase 1 p20 antibody

Anti-Caspase-1 Antibody

A00048 100ug
EUR 432
Description: Rabbit Polyclonal Caspase-1 Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse, Rat.

Caspase 1 (CASP1) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Caspase 1 p20 Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Caspase 1 (CASP1) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Caspase 1 (CASP1) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Caspase 1 (CASP1) Antibody

  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Caspase 1 (CASP1) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Caspase 1 (CASP1) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Caspase 1 (CASP1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Caspase 1 (CASP1) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Caspase 1 (CASP1) Antibody

  • EUR 467.00
  • EUR 133.00
  • EUR 1358.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Caspase 1 (CASP1) Antibody

abx037580-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Caspase 1 (CASP1) Antibody

abx038263-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Caspase 1 (CASP1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Caspase 1 (CASP1) Antibody

abx148921-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Caspase 1 (pS376) Antibody

abx148922-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Caspase 1 (CASP1) Antibody

  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Caspase 1 (CASP1) Antibody

  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Caspase-1 Conjugated Antibody

C48847 100ul
EUR 397

Polyclonal Caspase-1 Antibody

APG02382G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Caspase-1 . This antibody is tested and proven to work in the following applications:

Caspase 1 (CASP1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Caspase 1 (CASP1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Caspase 1 (CASP1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Caspase 1 (CASP1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Caspase 1 (CASP1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Caspase 1 (CASP1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

A brand new program, TALOS-N, is launched for predicting protein spine torsion angles from NMR chemical shifts. The program depends much more extensively on the usage of educated synthetic neural networks than its predecessor, TALOS+. Validation on an impartial set of proteins indicates that spine torsion angles can be predicted for a bigger, ≥90 % fraction of the residues, with an error price smaller than ca 3.5 %, utilizing an acceptance criterion that’s practically two-fold tighter than that used beforehand, and a root imply sq. distinction between predicted and crystallographically noticed (ϕ, ψ) torsion angles of ca 12º. TALOS-N additionally reviews sidechain χ(1) rotameric states for about 50 % of the residues, and a consistency with reference constructions of 89 %.

Evaluation of the Infinium Methylation 450K technology.

Evaluation of the Infinium Methylation 450K technology.
Studies of DNA methylomes maintain monumental promise for biomedicine however are hampered by the technological challenges of analyzing many samples cost-effectively. Recently, a serious extension of the earlier Infinium HumanMethylation27 BeadChip® (Illumina, Inc. CA, USA), known as Infinium HumanMethylation450 (Infinium Methylation 450Ok; Illumina, Inc. CA, USA) was developed. This upgraded expertise is a hybrid of two totally different chemical assays, the Infinium I and Infinium II assays, permitting (for 12 samples in parallel) evaluation of the methylation standing of greater than 480,000 cytosines distributed over the complete genome.
We used Infinium Methylation 450Ok to profile: first, the well-characterized HCT116 wild-type and double-knockout cell traces after which, 16 breast tissue samples (together with eight regular and eight main tumor samples). Absolute methylation values (β-values) had been extracted with the GenomeStudio™ software program after which subjected to detailed evaluation. In this text, we consider Infinium Methylation 450Ok on cell traces and tissue samples, highlighting some of its benefits but in addition some of its limitations. In explicit, we examine the methylation values of the Infinium I and Infinium II assays.
While this expertise appeared extremely sturdy as beforehand proven, we seen a divergence between the β-values retrieved from the sort I and kind II Infinium assays. Specifically, the β-values obtained from Infinium II probes had been much less correct and reproducible than these obtained from Infinium I probes. This means that information from the sort I and kind II assays must be thought of individually in any downstream bioinformatic evaluation. To have the ability to cope with the Infinium I and Infinium II information collectively, we developed and examined a brand new correction method, which we known as ‘peak-based correction’. The concept was to rescale the Infinium II information on the foundation of the Infinium I information. While this system must be seen as an approximation methodology, it considerably improves the high quality of Infinium II information.
Infinium 450Ok is a strong method in phrases of reagent prices, time of labor, pattern throughput and protection. It holds nice promise for the higher understanding of the epigenetic part in well being and illness. Yet, on account of the nature of its design comprising two totally different chemical assays, evaluation of the complete set of information will not be as straightforward as initially anticipated. Correction methods, reminiscent of the peak-based method proposed right here, are a step in the direction of enough output information evaluation.
Astrocytes set up speedy cell-to-cell communication via the launch of chemical transmitters. The underlying mechanisms and purposeful significance of this launch are, nonetheless, not properly understood. Here we determine an astrocytic vesicular compartment that’s competent for glutamate exocytosis. Using postembedding immunogold labeling of the rat hippocampus, we present that vesicular glutamate transporters (VGLUT1/2) and the vesicular SNARE protein, cellubrevin, are each expressed in small vesicular organelles that resemble synaptic vesicles of glutamatergic terminals.
Evaluation of the Infinium Methylation 450K technology.

Physiological, morphological, and histochemical characterization of three courses of interneurons in rat neostriatum.

Interneurons in lateral half of neostriatum had been studied in remoted slices from juvenile rats (16-20 d postnatal) by whole-cell, current-clamp recording at 33-34 levels C, adopted by intracellular staining with biocytin and double immunocytochemical or histochemical staining for parvalbumin, ChAT, and NADPH diaphorase. Medium-sized spiny neurons (MS cells) had distal dendrites with many spines and had been doubtless projection cells, whereas interneurons had dendrites with fewer spines. The neostriatal interneurons might be additional divided into three courses by physiological, chemical, and morphological standards.

The top notch of interneurons (fast-spiking cells, FS cells) fired very short-duration motion potentials with short-duration afterhyperpolarizations at fixed spike frequency throughout depolarizing present pulses. FS cells had extra destructive resting potentials and decrease enter resistances than the different two courses. At depolarized potentials, FS cells fired repetitive spikes in response to synaptic excitation. FS cells had been immunoreactive for parvalbumin. As all parvalbumin-immunoreactive cells in the neostriatum had been additionally immunoreactive for GABA, FS cells had been thought of to be GABAergic.

FS cells had been additional divided into two morphological varieties: FS cells with native dendritic fields and FS cells with prolonged dendritic fields. The axons of each varieties of FS cells had their densest collateralization inside or close to their dendritic fields. The different two courses of interneuron, PLTS cells (persistent and low-threshold spike cells) and LA cells (long-lasting afterhyperpolarization cells), had been distinguished from FS cells by longer-duration motion potentials and bigger enter resistances, had much less destructive resting potentials, and had longer-lasting afterhyperpolarizations.

Mouse Protein CASC4, Casc4 ELISA KIT

ELI-33003m 96 Tests
EUR 865

Human Protein CASC4, CASC4 ELISA KIT

ELI-33933h 96 Tests
EUR 824


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CASC4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV708321 1.0 ug DNA
EUR 316

CASC4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV708325 1.0 ug DNA
EUR 316

CASC4 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV708326 1.0 ug DNA
EUR 316

CASC4 ORF Vector (Human) (pORF)

ORF001883 1.0 ug DNA
EUR 95

CASC4 ORF Vector (Human) (pORF)

ORF001884 1.0 ug DNA
EUR 95

Casc4 ORF Vector (Mouse) (pORF)

ORF040409 1.0 ug DNA
EUR 506

Casc4 ORF Vector (Mouse) (pORF)

ORF040410 1.0 ug DNA
EUR 506

Casc4 ORF Vector (Mouse) (pORF)

ORF040411 1.0 ug DNA
EUR 506

Casc4 ORF Vector (Mouse) (pORF)

ORF040412 1.0 ug DNA
EUR 506

Casc4 ORF Vector (Mouse) (pORF)

ORF040413 1.0 ug DNA
EUR 506

CASC4 cloning plasmid

CSB-CL764724HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 534
  • Sequence: atggtgggtttcggggccaaccggcgggctggccgcctgccctctctcgtgctggtggtgctgctggtggtgatcgtcgtcctcgccttcaactactggagcatctcctcccgccacgtcctgcttcaggaggaggtggccgagctgcagggccaggtccagcgcaccgaagtggc
  • Show more
Description: A cloning plasmid for the CASC4 gene.

CASC4 cloning plasmid

CSB-CL764724HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1302
  • Sequence: atggtgggtttcggggccaaccggcgggctggccgcctgccctctctcgtgctggtggtgctgctggtggtgatcgtcgtcctcgccttcaactactggagcatctcctcccgccacgtcctgcttcaggaggaggtggccgagctgcagggccaggtccagcgcaccgaagtgg
  • Show more
Description: A cloning plasmid for the CASC4 gene.

Human CASC4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CASC4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CASC4 Recombinant Protein (Human)

RP005647 100 ug Ask for price

CASC4 Recombinant Protein (Human)

RP005650 100 ug Ask for price

CASC4 Recombinant Protein (Mouse)

RP121223 100 ug Ask for price